Skip to main content

Table 1 PCR primer sequences, amplicon length and annealing temperature used in Retn gene analysis

From: Diet-induced variability of the resistin gene (Retn) transcript level and methylation profile in rats

Type of analysis Gene Primer sequence Amplicon length Anneal.temp.
Transcript level analysis Retn F: 5′ CCACGTACTTAACAGGATG 3′ 195 bp 62 °C
R: 5′ GAGGAGACTGACCAGCAAT 3′
Hprt F: 5′ CAGTCAACGGGGGACATAAAAG 3′ 146 bp 62 °C
R: 5′ ATTTTGGGGCTGTACTGCTTGA 3′
Tbp F: 5′ ATCCTTCACCAATGACTCCTATG 3′ 190 bp 62 °C
R: 5′ ATGATGACTGCAGCAAACC 3′
Methylation analysis (converted sequence) Retn F: 5′ GTGGAAAGGAGGAATGTATTATTTG3′ 249 bp 56 °C
R: 5′ACAAATAAAAAAACTTTAATATTTATTCA3′
  1. Reference sequences for the Retn - GenBank: NC_005111.3; the Hprt - GenBank: S79292 and the Tbp – GenBank:NM_001004198
\