Skip to main content

Table 3 Primer Sequences Used in the Validation Analysis

From: Exome sequencing of a family with lone, autosomal dominant atrial flutter identifies a rare variation in ABCB4 significantly enriched in cases

Gene Forward Primer ( 5 ′- 3 ′) Reverse Primer ( 5 ′- 3 ′) Tm C )
SPAM1 CAGAAATCTTGCTTGCTCCTAG TTCAAGTGTCGGTTTTCCAC 58
IFITM10 CAGCACCACGGACGGC GGCAGGGGGCTTGGAC 64
CACNA2D1 CTGTGTTAGGTAACGCGGAT CTGAAAAACACCCACAACTG 57
ABCB4 CTGCTAGACATGGCTGCCAG TTCATTTTGGACTTTGGCAGC 62
FBXO22 CCTCTGGATATTGATGCCTC CTTTCTAAATGCATCAGCCTC 57
CEP164 TCTTTGACTCCTGATTGTGGG CTCTTGCTTGGATTCCAGCAG 61
TRIM54 TTCATGCTTAAGGTCCACCTC ACAGTCCTTGTGGGCACCGAAG 63