Skip to main content

Table 5 The sequences of the oligonuclotides and the size of the corresponding PCR products used for sequencing of different regions of the bovine NPY gene

From: Mapping of the transcription start site (TSS) and identification of SNPs in the bovine neuropeptide Y (NPY) gene

Primer Nucleotide sequence Product size (base)
NP0 For 5'CCAAAACCAAGCTGGGAAAAG 3' 1427
  Rev 5'GGTCCAGTAGCAGAGCCAAG 3'  
NP1 For 5'GGGCAGACCAAAACTGAAAA 3' 1252
  Rev 5'CACCAAGTGGGCATTTTCTT 3'  
NP2 For 5'TGCCCAGACTGAAGTGAAAAG 3' 1160
  Rev 5'GGAGGGCTCCAATTTAATCAC 3'  
NP3 For 5'TCCTAGGCATTACTTTGTTCAGTC 3' 1090
  Rev 5'AGGTACCCAGAGCAGCATCA 3'  
NP4 For 5'ACCCCCAGGGTGATTCTAAC 3' 1009
  Rev 5'TGCACATTACTGCTGCTGAA 3'  
NP5 For 5'TGGACCAGTAGGTTTCCTTCA 3' 1153
  Rev 5'GCAGGCGTCTTTTCACTTTC 3'  
NP6 For 5'ACTTGGGGCTTTCTTGGAGT 3' 1020
  Rev 5'CTTCCAGCCTGTCAAACACA 3'  
NP7 For 5'CAGCAGCCTTTTCAACAGTTT 3' 1115
  Rev 5'TGCTACAGGGATTTGGTAAGC 3'