Skip to main content

Table 2 Genetic markers used in the linkage analysis [18, 27, 28, 11]

From: Equine Multiple Congenital Ocular Anomalies maps to a 4.9 megabase interval on horse chromosome 6

Marker Position (bp)
Ensembl [18]
Forward primer (5'-3')/
Reverse primer (5'-3')
Accession number/Reference
UM015 34558444 AGTCTGGCTGAGGATACTG
GGTGAGAAAGGAGATAAATG
GenBank: AF195133
Chowdhary et al. [27]
UCDEQ465 61228896 AACCAGTCCCTACATAGAAC
CTCACAACCAAGCATACA
GenBank: U67414
Chowdhary et al. [27]
TKY570 66793583 TCTCCGCAGCTCAAACTTTC
CTCAAAGGTGCCTGAGAAGC
GenBank: AB103788
Tozaki et al. [28]
TKY412 70589360 GTGTGGGACAGGAAGTTTGG
ATTCTTGGGTCCCCTCATCT
GenBank: AB103630
Tozaki et al. [28]
UPP5 71164435 GCACAGTCTAGGGGGTGTGT
TCTGGGCCTGGGTAGGTAGT
Probe ID: 9710436
This study
Pyroseq. PCR primers-PMEL17 ex11
Pyroseq. Seq primer-PMEL17 ex11
73665164
73665164
Biotin-TCCATTGCTTACCAGTTTCCTT
CTCACCAAAGGGGGAAGAG
GCCCTGCTTCATAAGTCTG
GenBank: DQ855465
Brunberg et al. [11]
UPP6 74667027 ATTGTACCTGGGACCCTTCC
TGTCTTTGCTTCCCAGTCCT
Probe ID: 9710437
This study
UPP7 75475262 CTTTGACACACCCTGGGAAG
CATCCACATCCTTCATTTGCT
Probe ID: 9710438
This study
UPP8 76228607 TGTCCCTGAATTCTCTGATCC
GACCTCCAGTCAAAATGAATCTG
Probe ID: 9710439
This study
TKY952 79472871 GATCGGTAAGTGTCGGGAC
TAAAATGACTGGGTGGAGAC
GenBank: AB104170
Tozaki et al. [28]
UPP9 79806071 AAAAAGAGGATTGGCAACG
TGTGTGGGGATGTAATTGGA
Probe ID: 9710440
This study