Skip to main content

Table 2 Location of selected indel-markers (position on the respective chromosome in the dog genome assembly), primer sequences, amplicon length and expected heterozygosities from the genotyping of 18 wolves from worldwide.

From: Insertion-deletion polymorphisms (indels) as genetic markers in natural populations

No. Chromosome Position Primer F Primer R Fragment length (bp) He
1 23 35377868 ccaggcttgtgtgaagctct gccttgttggtttcagtggt 126 0.43
2 21 44954960 tgtcatttggccagatctctaa ttggattaaccctaccacacg 117 0.26
3 5 56432744 catgctgcttgaagtgcaata tctctgtgtgcctctcatgaat 123 0.00
4 6 31824728 cacaatgaccacttattaaagattaca ctaggatgagagcccagctt 139 0.00
5 29 17604384 tgtcaggtttcatatccttttgtg gaactatccttaaatagaaccaatgc 111 0.29
6 15 52623379 ttcacatccatctgtcttgga acccgggagtttgcctatac 125 0.20
7 12 4364137 ctcctgttccctccagca ggaccatgctgtggatctg 115 0.17
8 30 32665884 agaccagggtctgaatttgc tttccaaggtcccaccacta 116 0.24
9 7 52754426 ttcacaaattgctatacctaaaaatg ttcctgtgggcataataatca 136 0.48
10 26 32666193 tccaagaacaaagaagtaatgtaaaa ggaattgatttactgatagtgagatg 130 0.39
11 37 18098142 gaaaggtccctctgaattgaa tctgtgctcttcactggaaaaa 122 0.18
12 14 38060282 gtgtgctctaggggccatt gaatgaaatcatggaagagcaa 115 0.30
13 17 46184901 gaagggacaaaaccttggaa tgaactaccctcgtgatcca 139 0.37
14 28 38785954 aaaggagggcttgcagtttt ttctccttttagaccctttgtca 90 0.32
15 25 8846761 tgccttagcgttggcatt tggtgctctttcttgttgga 169 0.36
16 34 7543229 caggagcaaagtaagggtaatca gctttggtattgttgattctattgtaa 90 0.44
17 20 21505420 aatggggacaccagtcactt tgggagttctggctccac 139 0.00
18 1 32746664 tcctgcggcagtttgg ccaagattgtgcatgtcagg 104 0.36
19 23 42171234 caaaggcaagaaggcagatg tacatggtccctgtgttcca 81 0.51
20 35 25523850 ttagcgatgttgagcgttttt ttcccttaagaaataggcagagg 92 Excluded
21 22 41896467 tgcaaaggagtgggaattatc tggatgttaaaaacctggtatattgt 164 0.37
22 30 32665884 ccaagccccttccaatacta tttccaaggtcccaccacta 92 0.29
23 10 55417044 tgctttgcatgttacattcttca catgtcatagtcacatgctgtacg 151 0.32
24 22 20849044 tattgctgccctgtttcaga gctgaaggaaatatctgttgaatg 102 0.16
25 24 40849741 ctgcggtctcacatccttag tgagggggatttgatctctt 69 0.14
26 31 8148287 tctgctcaggtttagccttg ggatgcaagaaaatctgctg 80 0.43
27 3 67261495 ttactcccagctctgtgcat gacccaggtggggatatcta 88 0.06
28 26 37097342 tgcccccactactcttgc aaagggtgatggtcctttga 98 0.09
29 1 109880549 tgttgagcccttgaaatgag agcgaaaagtggcagtgg 68 0.51
30 13 20047698 tggctgccccatcttatg cacaatggcagaacacgag 78 0.06
31 10 13999933 gccttcttcctctgcctct ctcaggcaggcaaataaaaa 90 0.13
32 5 6092689 gcttgggaaatcatggtca gctaaggaaagcaagctgga 100 0.50
33 3 52499600 tctgactggcctccttcg attcaagtgtgcccgagag 67 0.51
34 2 87005110 gccgccgtgtcttgtc cgaatgcgtgcttaccg 80 0.07
35 5 16794632 cgatgctggtgaggaagc ccatccctgagccacct 91 Excluded
36 1 40637985 aagggccgatgccagt caggttcttgtttccccaaa 100 0.42
37 14 16593885 cccaggtgccccttattt ggctcatgctgctctgg 110 0.00
38 38 3128143 gcttcccttgtttctttcca tgcccatgtaccaaatgaa 121 0.51
39 6 78974466 gtagggcaagcggcaag tgcttcctggacatttgga 110 0.14
40 4 68490768 ttgcttgggaacatggag gcccttgtcatccactagga 121 0.00
41 1 41518626 cctggtgcaggttgcag ccttcggagcccatgc 106 0.42
42 19 29399024 caggacacttgcaccagatt gagcagaggtgaggctgaa 120 0.00
43 12 27463695 cagtagccaaattgtggaagc accacgtagtcttgacccattc 68 0.30
44 16 10834862 gttcccttctcagaggacca caatgagtgaagggggtcag 69 0.00
45 14 38539141 gagtggcacacgagcactt gcaggactgtctggaggttg 68 0.31
46 8 60840667 tgcctgagggagctgtatatg tctcattgtggagcaaagacat 75 0.51
47 5 36083663 gctttgttgtaagcagcgata tgtgagaaactccattgcctta 74 0.21
48 7 53313567 agaaggggcagacttgagg tccctcatttcacaagctga 75 0.19
49 1 88201810 tggctcattgatttgtgattct ggccagctcttcttgttgag 78 0.00
50 14 61925547 gggttctctagggagatgacaa aggacccaagtggattctga 83 Excluded
51 7 17212546 gtcatggtgacatcgcagtt gcctcatgccaatgagagac 85 0.12
52 2 67041786 gatggccgattgtacatcaa tggttgcagggaagattagg 95 0.34
53 5 3965764 ccgtctagttgtcgggtgtt tgcagtatttagggtggagga 94 0.43
54 34 24388648 cccttgtaaaggggaggaga tggctctgaatttaggcattt 94 0.48
55 12 23053279 agctctcctgctgtgattttt tgcagacaaatggactgaaga 98 0.44
56 20 29687857 tgagcacgaagaggtagagaag tcaagtgcaagtcaccaaact 100 0.43
57 30 37964459 cgtgaatggtccaaaatgat catcagcatttccagagttctt 100 0.26
58 13 42973844 tttctgggcaaaaacagtga tttagatgggagggaatggtt 108 Excluded
59 5 91665974 accttctgtttcccctttgg agagcgcagcagagatgact 103 0.00
60 4 43098715 gtttacaccacccagcctga aggcagttacaggcattaatca 109 0.40
61 20 40585796 cccatccctgaggaagagag ggacacccgcatttctgtc 114 0.12
62 7 8798933 cccagaaaacaagagaaggaaa tgttggcagatctcatggtc 114 0.00
63 14 23314695 acccaccagattggctaaaa tcgaacaggtccagtttacatt 116 0.26
64 26 35769409 cctggcttaaccccttacct aaccgctatcccacattctg 96 0.00
65 4 56495029 tcccactgtagcttgaaaacg ttcaggtattgctgtccaaaaa 95 0.51
66 17 19537687 atgctttgcagagatgcttg tgctcatgtcagaacagagagg 94 0.31
67 31 26928202 atgaacaagcaccccaaaac cagtccacttcaatgcacca 68 0.27
68 10 66801300 ccccaaattaagggaagttca tccatgaccaaatctgcatc 70 0.12
69 10 63275151 tccagaacttggagagaatcaa tccaggcaagactatgagca 70 0.30
70 5 58727403 ctggaccacatatggcttga tgccggagagatacgtgtaa 72 0.00
71 5 29583832 ccacacagtgttgcctgtagt ggaaagcacagaaagttgtgaa 73 0.49
72 11 25068367 cccctgcttgtgctctctc ctctcagcaacccacagagat 75 0.49
73 19 54304531 aagccttgcacttgagcttg ccattggaaaggcacgtact 77 0.27
74 30 39573069 gcttttgtcatgaaacaccaa ccaccagatgctcaagtctg 79 0.48
75 19 55236292 gcccacagggtctttattttt gcttgggtctcttcctctctc 78 0.33
76 3 53761240 ctgtggtgcagcggtttag ggagcctgacatgggactt 78 0.00
77 4 90768017 gttctccctgtgtctgactgtt aaagaccaaggggtgaaaga 84 0.13
78 11 57430384 agggacagacccactaagtgtc tccttaggcgacatggagac 86 Excluded
79 36 32128918 tgatatagccgaagtcaggaag aatggaaagatcatccagacag 89 0.40
80 14 49479392 tttcaaattgctgaatgttgg ccctggtctccaggatcac 89 0.47
81 27 13108059 cagccaattggacacaaaaa aaaatcaagatgtcagcagagg 88 0.00
82 6 61627505 gtcatgatcccatggtccta gtagaggggcagagggagag 88 0.00
83 36 14699428 gtgttttcttttgggcaagg tgcaaccaacacacagatga 92 0.49
84 32 36108071 cccagtgttggtcacatataca gcgatgaaaattgggaaaga 96 Excluded
85 17 57586353 gtgattagggttgaggggaga ttttccatcaaggtttgtcca 97 0.42
86 5 16750608 aattttccaggaggctttgg ttccctcctgctgatctagg 98 0.06
87 19 43306776 tggggtaaatcagtgagtgaag ggcattaagagaagcctgctg 99 0.07
88 29 43945653 aacccgaataacattaggagga tgggtttaagctggttacgg 104 0.51
89 5 31951980 cccagaaatccacttaatgacc tgtgttaccagggctaggttc 104 0.44
90 7 50783779 ggttagcttagctcctctccaa agccacatgctgaaaggaag 104 0.00
91 31 10957463 ttggcaactgccttacaataaa ttgaatgtggacatgaaacaaa 106 0.47
92 16 6629437 gaaatgggaaggttttattcca ggtgctgacaacagaaaacct 109 0.46
93 5 75136583 aggacacagacagatgtgagga ccgaagaggaatctgcactc 111 0.00
94 3 89213750 gagaacttcgatgtgagggaat ctctcccaccaaaaatctcct 113 0.29
95 21 51457175 aggcattcagggtgttaaaaa tggtgaactggaaagtagctga 108 0.51
96 12 53379600 ttcccaaggagttggagaga gctgagggcagctgtgttat 68 0.00
97 14 58723304 ccctgtggtaaccatcaacc caaagtgaacaagcaaagcaa 67 0.51
98 3 11002853 ccactggccctaagtgactg ttagggttttaaaggctgtgc 70 0.06
99 30 30015918 tcaggttttggatttgaagga taagcacaaccattagctcca 72 0.06
100 7 65831405 gaggttcaaatttcccatatcc gggatccatgcaaaatagttc 73 0.37