Skip to main content

Table 1 The sequences of the forward and reverse primers flanking the promoter, 19 exons, and 3'flanking sequence for canine FGFR3 (Genbank Accession: EU853457), annealing temperatures, and amplicon sizes

From: Canine fibroblast growth factor receptor 3 sequence is conserved across dogs of divergent skeletal size

Ensembl Exon Forward Reverse Anneal (°C) Amplicon (bases)
Promotera gacgcgtggcctagattc gagcatgtgcccctgatac 60 699
1 and 2 caaacctcccagaacaggac cccgcagggatacagtctt 61.5 833
3 cgtgtgcaggtgctcagtat gtgtcctcagcctcatcctc 60 495
4 cgtgcgtgtgacaggtaaat ctgcagtacaggtccccaac 59 394
5 accatgtggcttagccttga tgtttctccacaacgcatgt 59 472
6 ccatctcgtggctgaagaac gctgtacaccttgcagtgga 58 437
7 acatgcgttgtggagaacaa taccacttctcccctgatgg 55 399
8 IIIbb cagcatttctgactgcagga ggctcggaacctggtatcta 58 401
8 IIIcc atgtggactctggctgtggt cacgagttctgtggagcaag 60 301
9 acacccccttctccattctc gagtgcagtgcgagtctcag 59 407
10 tggagcctgggttatttgtc cagtcatcacactgcccatc 59 500
11 aaggttgtggggcaagtatg ccaggtctgagaggtccttg 59 358
12 aggccatcggtattgacaag gtacaggggtcttggagcag 60 349
13 tccttcctgcacagatgatg aagctcccaagtggtcctg 58 461
14 ttctccctccccccccttccccagac tcccgagggcaggggcccttgtc 59 350
15 cagccaggccctggctgccgccac agggcacctggccgtcaacatgc 59 394
16 accgagtctacacccaccag acaatgcctcccatgacc 59 426
17 atggacaagccagccaact ccgacaggtccagatactcc 60 401
18 and 3' flanking gcagctagtggaggatctgg cacaccaccagcagcatagt 60 361
  1. a. Amplicon represents the putative promoter region
  2. b. Exon indicating the FGFR3 IIIb isoform
  3. c. Exon indicating the FGFR3 IIIc isoform