Skip to main content

Table 3 Primer nucleotide sequences of polymorphic microsatellite markers in RBr

From: Mapping the Anthocyaninless (anl) Locus in Rapid-Cycling Brassica rapa (RBr) to Linkage Group R9

Microsatellite Reference Primer sequencesa
Bn9A [28] GAGCCATCCCTAGCAAACAAG
CGTGGAAGCAAGTGAGATGAT
BRMS-006 [23] TGGTGGCTTGAGATTAGTTC
ACTCGAAGCCTAATGAAAAG
BRMS-024 [23] TGAATTGAAAGGCATAAGCA
CAGCCTCCACCACTTATTCT
BRMS-033 [23] GCGGAAACGAACACTCCTCCCATGT
CCTCCTTGTGCTTTCCCTGGAGACG
BRMS-034 [23] GATCAAATAACGAACGGAGAGA
GAGCCAAGAAAGGACCTAAGAT
BRMS-037 [23] CTGCTCGCATTTTTTATCATAC
TACGCTTGGGAGAGAAAACTAT
BRMS-040 [23] TCGGATTTGCATGTTCCTGACT
CCGATACACAACCAGCCAACTC
BRMS-042-2 [23] AGCTCCCGACAGCAACAAAAGA
TTCGCTTCCTTTTCTGGGAATG
BRMS-050 [23] AACTTTGCTTCCACTGATTTTT
TTGCTTAACGCTAAATCCATAT
CAL-SSRLS-107 [29] GTTAAGTGTGGCGTTAGAGG
CCTTGGTACATGCCACTGAA
Na10-G10 [30] TGGAAACATTGGTGTTAAGGC
CATAGATTCCATCTCAAATCCG
Na12-H09 [30] AGGCGTCTATCTCGAAATGC
CGTTTTTCAGAATCTCGTTGC
Ra2-A01 [30] TTCAAAGGATAAGGGCATCG
TCTTCTTCTTTTGTTGTCTTCCG
Ra2-D04 [30] TGGATTCTCTTTACACACGCC
CAAACCAAAATGTGTGAAGCC
Ra2-E04 [30] ACACACAACAAACAGCTCGC
AACATCAAACCTCTCGACGG
Ra2-E07 [30] ATTGCTGAGATTGGCTCAGG
CCTACACTTGCGATCTTCACC
Ra2-G04 [30] AAAACGACGTCATATTGGGC
CGCTTCTTCTTCTCAGTCTCG
Ra2-G05 [30] GCCAACTTAATTGATGGGGTC
CCTCAATGTTCTCTCTCTCTCTCTC
Ra2-G09 [30] ACAGCAAGGATGTGTTGACG
GATGAGCCTCTGGTTCAAGC
Ra2-D02B [30] CACAGGAAACCGTGGCTAGA
AACCCAACCTCAACGTCTTG
Ra3-H09 [30] GTGGTAACGACGGTCCATTC
ACCACGACGAAGACTCATCC
Ra3-H10 [30] TAATCGCGATCTGGATTCAC
ATCAGAACAGCGACGAGGTC
  1. Nucleotide sequences of primers were from [31].