Skip to main content

Table 1 Characteristics of 27 fragments used to test separation of CTCE

From: Technology to accelerate pangenomic scanning for unknown point mutations in exonic sequences: cycling temperature capillary electrophoresis (CTCE)

# Gene symbol NCBI rs number DNA variant PCR primer "Forward" 5'-3' PCR primer "Reverse" 5'-3' Mean melting, °C Δ mean melting, °C Fragment length, bp
1 BRCA1 rs799923 T59C *gtccatggtgtcaagtttct gttggacactgagactggtt 70.7 0.6 147
2 BRCA1 rs16940 T42C *accccaaagatctcatgtta cgagatactttcctgagtgc 68.9 0.4 154
3 MTHFR rs1801133 T28C *catccctattggcaggtt aagaaaagctgcgtgatg 75.3 0.3 159
4 OPSIN ac092402 T51G *tctgtctttgctgcttcac tttagaaaatgcctttggtc 70.6 0.1 159
5 MTHFR rs1801131 A41C *actccagcatcactcact gagctgctgaagatgtgg 73.5 0.5 157
6 MTHFR rs2274976 A35G *ccaggttgaccaggaagt gtgtaggacgaggccttt 75.7 0.3 156
7 CBS rs234706 A45G *ggtgactgaggtgtcagg gacgcaccatcacactg 77.6 0.5 168
8 NQO1 rs1800566 T25C *ctcatcccaaatattctcca tctgtggcttccaagtctta 72.6 0.2 157
9 DPYD rs3918290 A53G *caccaacttatgccaattct tgcatattggtgtcaaagtg 68.3 0.6 138
10 DPYD rs17376848 T43C *caccaacttatgccaattct tgcatattggtgtcaaagtg 69.0 0.3 138
11 DPYD rs1801265 T30C *tcaggatttcttttccaatg atcctcgaacacaaactcat 70.5 0.7 120
12 CTLA-4 rs5742909 T40C *tcgaaaagacaacctcaag aggaaattctccaagtctcc 67.8 0.3 175
13 COL1A1 rs1007086 A64G *ctaaggatgggaggcacga ccccctgtaagtatcactcc 76.5 0.2 132
14 COL1A1 rs1061237 T30C *ttcctgtaaactccctccat tgaaattgtctcccattttt 73.7 0.2 164
15 COL1A1 rs2857401 T54G *ctgagatggcagttcttga ctaaatgtctgttccctcca 74.1 0.2 155
16 COL1A1 rs2249492 T68C *catagtgccctctctccat gaggtcttggtggttttgta 76.0 0.4 161
17 COL1A1 rs2277632 A49G *ctctccctccctcctactc aatccagtactctcctgtgg 76.6 0.2 166
18 COL1A1 rs2075558 A48G *catttttcatcaccgactg agtaatggaggcaggaagat 75.8 0.2 168
19 COL2A1 rs2070739 A46G *cagtgtacgtgaacctgcta acctaccactgcaagaacag 76.5 0.3 168
20 COL2A1 rs2276454 T33C *tccaggtcttcagggaat tgagaggctgtaacctcagt 76.7 0.6 131
21 COL2A1 rs2276455 T61C *ggtgagatgaaggaacagg ctggtgatgaaggtttctgt 71.2 0.3 143
22 COL2A1 rs1635550 T57C *agaagtacctttgcccaatc caggaagaccctagacagaa 71.8 0.6 131
23 COL2A1 rs1635537 T94C *agaaacttgctttgccttct ctccttccctcctctgtact 72.5 0.3 166
24 COL2A1 rs1793958 T25C *gatcttgagctcttcattgc catgaggatatggaggtgac 71.9 0.3 142
25 COL11A1 rs2229783 T87C *gtctgagtacccattggaaa caagcagatgcagatgataa 67.3 0.3 157
26 COL11A1 rs3753841 T63C *attctagggtcctgttggtt aattggaaacattcactcca 70.2 0.2 151
27 COL11A1 rs2615987 T55G *tgaatatgcacccttttctt tgaacaccagaatttgaaca 66.6 0.4 155
  1. For each target chosen, the consensus sequence and a known mutant sequence created by a single base-pair substitution were mixed, melted, and reannealed to create two homoduplexes and two heteroduplexes. For each target sequence, the designating number (#1, 2, 27), gene symbol, NCBI polymorphism reference number, specific mutation with its position in target fragment relative to the 5' end of the reverse primer, PCR primer sequences, average calculated melting temperature of the consensus homoduplex domain (including primer sequences), calculated change in melting temperature of the homoduplex due to the polymorphic base substitution and target fragment length without primers are shown. A thermally stable clamp sequence with a 5' fluorescent label (6-FAM) was synthesized separately for each test fragment incorporating the forward primer for each of the 27 target fragments. Clamp sequence: 6-FAM-CGCCC,GCCGC,GCCCC,GCGCC,CGTCC,CGCCG,CCCCC,GCCCG-forward primer.