BMC Genomic Data

Table 3 List of oligonucleotide primers, PCR conditions and oven temperatures used, for amplification and DHPLC mutational analysis of the human muscarinic acetylcholine receptor M5 gene.

From: Variation in the gene coding for the M5 Muscarinic receptor (CHRM5) influences cigarette dose but is not associated with dependence to drugs of addiction: evidence from a prospective population based cohort study of young adults

			PCR Conditions
Fragment Name	Primer Sequence Forward	Primer Sequence Reverse	Tm (°C)	Mg++ (mM)	Amplicon Size (bp)	Tm (DHPLC)
5'Exon 1. b-1	catctgctcctttctttcttcc	tgagaaatcctggttgttcct	59	2.5	469	56,58
Exon 1. b-1	ttctgaaatacgaacaagcaga	gcacgagcagatttaatttca	58	2	449	51,55,56
5'Exon 2. a-1	gggtcttgctatgtcatccag	ccttatgggaccactgttgtaaa	60	2	387	60,55.5
5'Exon 2. a-2	tgcaccacataccattttgg	ccggacacaatatcactgtctt	60	2	437	51,53,57
Exon 2. a-1	cattttgctgaccctaaagacc	tggacgcactacctttaaaaac	60	2	299	58,59,60
Exon 3. b-1	taacagcccctttgtgaacg	cctgtgggagaaatgtggtt	60	2.5	418	57,60,61
Exon 4. a\|b-1	acaagaaaatcatgctggtgtg	aggttcatggagaagattccaa	60	2	383	58,60
Exon 4. a\|b-2	gccagctcaagacagttaacaa	agagaaactggatctggcactc	60	2	390	60,61
Exon 4. a\|b-3	ttgggaagcggacagttc	tagctgctacaggtggtgagc	62	1.5	400	60,61,62
Exon 4. a\|b-4	caattgggccaaagctgag	Ctttcgttgaaggttccttgg	60	2	374	59,60
Exon 4. a\|b-5	atggctgtcacaaggtgaaaat	tgccagtacaacttctcttcca	60	2	394	58,59,60
Exon 4. a\|b-6	ctttaagatgctgcttctctgc	tcattgttacccagtgtgcttc	60	2	384	57,59
Exon 4. a\|b-7	gggagtttgccaatgaagtaaa	caagaccttcactcagatgtgg	60	1.5	375	55,57,59

Tm, annealing temperature for PCR amplification; Mg++, magnesium concentration for PCR amplification; bp, base pairs; Tm _DHPLC, column temperature (°C) for denaturing high performance liquid chromatography (DHPLC) analysis.

Back to article page

ISSN: 2730-6844

Contact us

General enquiries: journalsubmissions@springernature.com