Skip to main content

Table 3B Primers designed to screen the 5'flanking sequence of ENaC α, β, and γ genes. Optimum temperatures (°C) for PCR and DHPLC are included in the table.

From: Sequence analysis of coding and 3' and 5' flanking regions of the epithelial sodium channel α, β, and γ genes in Dahl S versus R rats

   Sequence PCR DHPLC
ENaC α     
  Forward CAGATTCAGCTGCCATGC 60 62
  Reverse AGGCCCTGCAGAACTTGCT   
  Forward GGTAGGAAGAGGCAGTGTGC 61 62
  Reverse ACAGGGTTGCAGGAATGTG   
  Forward GCTGGTGGTCTCTCCCAGTA 64 62
  Reverse GGTCCCTTCTGATGGAGGTC   
  Forward GGGGGACCCATTCTCCTT 62 59
  Reverse GGACTGATGGCGAACTGACT   
  Forward CCTTCCTGGCTTTTGTGTGT 61 62
  Reverse GTGTGGCTGGGCTGTGAC   
  Forward CAGGCACTGCACCTGTCA 62 62
  Reverse GGCTTAGCGTCTCTCCCTCT   
  Forward CACAGAAAGGGAGACCCAAA 60 63
  Reverse GGTCTTGCTCCTTGAATTGG   
  Forward GAGGGCAGCCTGGGATGCGG 61 62
  Reverse TTATAATAGCAATAGCCCCA   
  Forward TCCAAGGAGAAGGCGCCCCCA 61 62
  Reverse AGGGCTGGGTGAGAGGAT   
  Forward GGTTTAAGGATTTGCTTGATTC 61 61
  Reverse TGTTCTGCAAGGACAGCATC   
  Forward CAAAGTACCCAATATCTATT 61 61
  Reverse AGGGCTGGGTGAGAGGAT   
  Forward CCTGGTTTTGGGGTGTGT 61 61
  Reverse TGTTCTGCAAGGACAGCATC   
  Forward GCTCTCTTTGGGCTGTGGGGAC 61 61
  Reverse TGTTCTGCAAGGACAGCATC   
ENaC β     
  Forward GGTCTTCTGGGAAGAGCAAA 61 62
  Reverse CACGGTTCCATTTCCTGTGT   
  Forward CAGCCATGCACATGAAGACT 61 57
  Reverse TTGCAGCCAACTTGACTAGAT   
  Forward TGGTGATACCCTTCTTGTTGG 61 60
  Reverse CCTCCGTGTATCCTCACTCC   
  Forward AAAATAGAACGGGGCTGTGA 61 62
  Reverse GGAGCTGGGTCACCTGTAGA   
  Forward TGACCTGGAGCCTGTCAACT 62 64
  Reverse GACGGAACTGCGGTCATT   
ENaC γ     
  Forward CTTGACATGTTTCTACCCACCA 61 58
  Reverse TTAGAACGCTGAAACCGTGA   
  Forward CATCCTCAACTCAAGAATCTGC 60 60
  Reverse CCACTCTGCAAGCTGCATTA   
  Forward TGCAGAAGCAGCAGTAAGAGA 61 62
  Reverse CTGGCGTGTGTACAGTCTGG   
  Forward CTTCTGGCCGTGCCACTT 61 62
  Reverse TCGGGCTCCTCTTTCAACTA   
  Forward CGCGGGAAAGCTTTTCTTTA 61 63
  Reverse CTTGCTCCCTTCCCTCTCAC   
  Forward ATGAACAGAGCCTCGCAAAC 61 62
  Reverse GATAGTGGTCGCAGGTGACA   
  Forward GGTGGAAACGTTGGAATAGG 62 58
  Reverse AAAGCAAGGCTGTCGCTCTA