Skip to main content

Table 2 Sequences and primers for CMAH analysis in the cat.

From: Cytidine monophospho-N-acetylneuraminic acid hydroxylase (CMAH) mutations associated with the domestic cat AB blood group

CMAH Region Forward Primer 5' – 3' Reverse Primer 5' – 3' size bp
5'UTR – e1 TTCCTTTGCTGCTGGAGTG CAACACTGAGCAAGCAGAGC 653
Exon 2 CAACACTGAGCAAGCAGAGC GGTTTCCTCTCTCTCAGGGG 589
Exon 3 CTCTTAGGACATGGACTGAACG CTTTGGTAAGACGGGTGAGAG 458
Exon 5 GTGTCTGTCGCATCACCTCT GGATGAGAAGAAGCGGACTC 668
Exon 6 GGCAGAGAGCAGGAAGACAC TTTTCCCCCATTTACCAATG 571
Exon 7 TAGCCGATTTTTGTCTGTGC TCAACACTTCCATACATCACCC 669
Exon 8 GATCCCATCATGCTTCCTCT GAAACCAGACTTGCAAAGCA 630
Exon 9 GTGTCTTTGGCTGGTTTGGT GACTTTTAGCCACGCCATTC 642
Exon 11 GCCACACAGCTCCCATAGAC TGTTGTTGTGGGTTTTGTGG 624
Exon 12 CATGGTGTTTGCTGTCTCAT CCTCTACATGCTTACTGCCC 647
Exon 13 GACATGAGGGGTCGGTACG CTCAACTCCAGCGTGCATTT 579
Exon 14 TTCACTGTTGGATGATGTGG GACTTTCAGGGGAGTGAGAAG 700
1cDNAe2-6 GACGACGGAGGTCTTGTTGT TTACCCCACACTGAAGGAGC 608
1cDNAe5-11 CAAGAGGATGGTGTTTGACC GCATCATAGAGCCTCCAGAG 817
1cDNAe9-14 GGAATCTCACCCATCAGACA CTGTGGGTAGAGCAGACCTG 656
5' RACE   AAATACGTCAATCCCCCAGGCAGCTTCT ~500
3' RACE AACTCCCTCTCACGCCACCCAACTG   440
Δ-53 TCCTCCGTCTCATACTTTGTGG CATTTCCAGGGGAGCAGC 167
UTR SNPs 2GCCGGGTGTAAGGTTCTC CACCTGGAGCCCAATAGG 247
3C-371T   AGCACGTGTAGGCT  
3G-217A   AAGTGTGCAGGTG  
Exon 2 2CTGCTGACCTGAAGGAAGGAAT ACCCGTGAGAAGGCTCAGAA 187
3G139A   GGCGTGCAAGAACG  
Exon 3 TGTCAGATGCACAAAGCACAAC 2TGCTGTGATCGTTACTGGCGT 141
3T265A TGTGAGCACCATGAAA   
Exon 10 CGACTAACTGTCACCTTTGTGTCTT 2TGAATGCTGCTGTAGGAGATGA 128
3G1266A AAGCAAGGGCATCATA   
Exon 12 2ATTCGGAGCCGGGTTGAC CCTGTAAGTTGGAAAGTGCCTG 135
3G1591A   GTATATAGGATTCCAAACCC  
  1. 1. Nested primers for the cDNA analysis. The positions of the primer in the exons are indicated in the primer name. 2. The M13 tail was attached to the indicated end of the indicated primer. 3. Primer for the pyrosequencing reaction of each amplified SNP region.