Skip to main content

Table 3 LMW-GS gene specific primers designed based on consensus sequences of full-length LMW-GS cDNA clones and a genomic clone.

From: Hemi-nested touchdown PCR combined with primer-template mismatch PCR for rapid isolation and sequencing of low molecular weight glutenin subunit gene family from a hexaploid wheat BAC library

Primer Primer sequence Contig no.a Tm (°C) Product size (bp)
LMWF3 GACAAGTGCCATTGCACAGA 5, 3 60  
LMWR4 GCTGTACAACGGCACATTGA 5, 3 60 820
LMWF10 TCACAGCAACAACAACCACA 7 60  
LMWR9 CTATCTGGTGTGGCTGCAAA 7 60 784
LMWF11 CCAAACTCGGTTGCAAAAGT AY542898 60  
LMWR11 TGGTGGTTGTTGCGGTAGTA AY542898 60 805
  1. aContig number from Özdemir and Cloutier [20].