Skip to main content

Table 2 Position (base in bold) and type of paired base mismatch(es) between primer pair LMWF3/LMWR4 and eight BAC clone templates.

From: Hemi-nested touchdown PCR combined with primer-template mismatch PCR for rapid isolation and sequencing of low molecular weight glutenin subunit gene family from a hexaploid wheat BAC library

BAC clone (template) LMWF3 (5'→3') GACAAGTGCCATTGCACAGA Primer-template mismatch LMWR4 (5'→3') GCTGTACAACGGCACATTGA Primer-template mismatch N-terminal sequence
TaE0503E07 GACAAGTGCCATTGCACAGA No mismatch GCTGTACAACGGCACATTGA No mismatch METSCISG
TaE1238L16 GACAAGTGCCATTGCACAA A G:Ta GCTGTACAACGGCACG TTGA A:C METSRVPG
TaE0154F22 GACAAGTGCCATTGCACAA A G:T T CTA TACAACGGCACATTGA G:A, G:T MENSHIPG
TaE0359D24 A ACAAGTGCCATTGCACAA A G:T (2×) T CTGTACAACGGCACATTGA G:A IENSHIPG
TaE1157C20 GACAAGTGCCATTGCACAA A G:T GCC GTACAC CGGCACG TTGA T:G, A:G, A:C METSHIPS
TaE0703A09 GACAAGTGCCATTGCACAA A G:T GCC GTACAC CGGCACG TTGA T:G, A:G, A:C METSHIPG
TaE0099E23 GACATC TGCCATTGCACAGA A:A, G:G GCTGTACAACGGCACATTGA No mismatch METSCIPG
TaE0072P19 GACATC TGCCATTGCACAGA A:A, G:G GCTGTACAACGGCACATTA A G:T METSCIPG
  1. aThe first base from the primer and the second base from complementary sequence of template.