Skip to main content

Table 2 The Primers used for deletion analysis

From: Deletion of the V2 vasopressin receptor gene in two Chinese patients with nephrogenic diabetes insipidus

Primer* Sequence (5'→3') Location# Amplified regions TM (°C) PCR product size (bp)
6F CCTGGCACAGTTCCATGTAGT 3988533-3988513 Intergenic region between L1CAM and AVPR2 genes 61.86 299
6R TGAGCAGACAACCATCTCCTT 3988811-3988791   61.70  
7F CCTCGTCCTTGGCTGCCTCCTCTTT 3987895-3987871 Intergenic region between L1CAM and AVPR2 genes 55.00 299
7R CCGGTTCCCCATGATCAGAACCTT 3988169-3988146   57.14  
8F CATGTTCTTGGGCTCTCTCCT 3994343-3994363 Intron 21 of the C1 gene 62.55 361
8R CAGGGCTGAGTTAAGGCTGTT 3994683-3994703   62.49  
9F GGTGTCTTCTGTCCCTCTCAT 3994750-3994770 Intron 21 of the C1 gene 60.03 273
9R AGAGCAACACGTGGAGGTGGATAAG 3994998-3995022   61.86  
  1. * F, Forward Primer; R, Reverse Primer
  2. # GeneBank accession number NT_000054 for the AVPR2 gene, as well as upstream and downstream sequences.