Skip to main content

Table 1 Primers for PCR-SSCP analysis of p66Shc gene

From: Search for genetic variants in the p66Shc longevity gene by PCR-single strand conformational polymorphism in patients with early-onset cardiovascular disease

Amplicon Product size (bp) Forward primer (5'-) Reverse primer (5'-)
CH2 352 gcccctctttcacctcaact atgtcctggaggaggggtag
Promoter-1 238 cagagaagaggctccacgtt ggggcaggagatccatagtt
Promoter-2 247 cccacccccactttacttct aacgtggagcctcctctctg
Promoter-3 330 aggacaggaagggaaatgct agtgctgactcacaggctca
  1. Forward and reverse primer sequences are all 5'. Promoter-1 fragment starts at nucleotide -222 from start codon of exon1; Promoter-2 fragment starts at nucleotide -449 from start codon of exon1; Promoter-3 fragment starts at nucleotide -637 from start codon of exon1 of p66Shc gene.