Skip to main content

Table 1 Six new nuclear loci for each of two Collembola species. Markers were developed using four PCR-based methods (labeled A-D) in conjunction with SSCP plus DNA sequencing. Pseud., Pseudachorutinae n. sp.; Acanth., Acanthanura n. sp.

From: Development and application of three-tiered nuclear genetic markers for basal Hexapods using single-stranded conformation polymorphism coupled with targeted DNA sequencing

Taxon/locus Primer Sequence (5' to 3') Gene amplified Method Source of primers used for initial amplification (primer names)
Pseud.      
Sm2 Sm2-Fa GAAACGGGTGCTGGTTSRAGG Anon. nDNA A Operon Technologies (A07, A09)
  Sm2-R GGGTAACGCCRTTGGAAACAG    
Sm4 Sm4-F GAATTGGTGGGAGATCTCTC Anon. nDNA C [2] (ATPSα f1, ATPSα r1)
  Sm4-R TGTCGTCCGTCTATGATTCG    
Sm6 Sm6-F CTGAATGCCGTCGAAACGTAAAC Anon. nDNA B [57] (M49-F), [58] (myz3-R)
  Sm6-R GTTGGTTTACCTGTTTTAAATG    
Sm8 Sm8-F AGTGGGATTTTAGGATGGCAGG Anon. nDNA A/B [57] (M49-F), Operon Technologies (A07)
  Sm8-R CCAAGACTAAGATTGAGAAGAAGTC    
SmEF-1α UcEF-Fa see below EF-1α intron C This study (UcEF-F), [1] (EF2)
  SmEF-R CCAATMCCACCAATTTTGTAGAC    
Sm150 Sm150-F ATCCTACTCAAAACTCAAG Anon. nDNA D Not applicable
  Sm150-R ACCCTTGGATTTGGAATC    
Acanth.      
Uc3 Uc3-Fa CAGCGCGGTTTGGGTGTATA Anon. nDNA A Operon Technologies (A07, A10)
  Uc3-R GTGATCGCAGAAATCCCCGCA    
Uc180 Uc180-Fa CCAACTCAAGTTCGGATGAC Anon. nDNA D Not applicable
  Uc180-R CAAAGCGCTTAACTGGGTC    
Uc44 Uc44-F GATTATTACCAATCGCTATTGG Anon. nDNA A Operon Technologies (A07, A09)
  Uc44-R GGGTAACGCCAATTTAAGGTG    
UcEF-1α UcEF-Fa CCGAGAAGATGTCCTGGTTC EF-1α intron C [1] (EF0, EF2)
  UcEF-R CGGGCACTGTTCCAATCC    
UcANT UcANT-F CAGTGTCTCMGTKCAAGGAATC ANT intron C [2] (ANTf1, ANTr1)
  UcANT-R MTTGGGCGATWAKCCAKGAAAC    
UcWnt UcWnt-F AGAATAAGTTCCGTCGTGCTG Wnt C [59] (wg1a, wg2a)
  UcWnt-R GGATTGGAGTCGCAGTAGGTC    
  1. aPrimer used for sequencing.