Skip to main content

Table 3 Primers for PCR analyses

From: Epigenetic predisposition to expression of TIMP1 from the human inactive X chromosome

Primer pair Sequence Use
TIMP1 5' (promoter) [14] 5'A: CCCTTGGGTTCTGCACTGA*
5'B: CCAAGCTGAGTAGACAGGC
Methylation
ChIP
DNase sensitivity
TIMP1 CA (gene body) [12] CA1: GGGTTCCAAGCCTTAGGGGA
CA2: AGGCTGTTCCAGGGAGCCGC
DNase sensitivity
TIMP1 S (bisulfite) 5S: GttttTTGGtTTtTGtAtTGATGGT
3S: CCAAaCTaAaTAaACAaaCATCTAaC**
Bisulfite sequencing
ARAF1 M1:M4 (promoter) [14] M1: TGCCAAAGCCCTAAGGTCA
M4: CGCTGTCGACGATGGTCT
M3: GTGAGGAAACAAGAAGAGAG
Methylation
ChIP
DNase sensitivity
XIST 3':5' (gene body) [39] 3':GAAGTCTCAAGGCTTGAGTTAGAAG
5': TTGGGTCCTCTATCCATCTAGGTAG
Methylation
DNase sensitivity
XIST A5:29r (promoter) [37] A5: TTTCTTACTCTCTCGGGGCT
29r: ATCAGCAGGTATCCGATACC
ChIP
ELK1 5' (promoter) [14] A: GCACAGCTCTGTAGGGAA
B: AGCTCACCTGTGTGTAGCG
Methylation
ChIP
STA A:B (intergenic) A: CACCTGTGTGTCATGTATAC
B: CCAGTATTGGTCTTCCAGTT
DNase sensitivity
8037 A:B (intergenic) A: GAGGCAAGACATCCATTCC
B: TGACTTTGAGCGAGCAGGT
Reference region
  1. * There is a mismatch in the TIMP 5'A primer, the underlined G should be C.
  2. ** The lower-case letters in the primers are the bases modified by the bisulfite reaction. All C nucleotides should have been converted because there were no CpG pairs with possible protective methylation.