Skip to main content

Table 2 Nucleotide sequences of the adaptors and anchors used in Rim2/Hipa-TD.

From: Rim 2/Hipa CACTA transposon display ; A new genetic marker technique in Oryza species

Primer name Sequence
Adaptor  
KRMA-1 GACGATGAGTCCTGAG
KRMA-2 TACTCAGGACTCAT
MseI anchors  
KRMP-0 GACGATGAGTCCTGAGTAA
KRMP-AA GACGATGAGTCCTGAGTAAAA
KRMP-AC GACGATGAGTCCTGAGTAAAC
KRMP-AG GACGATGAGTCCTGAGTAAAG
KRMP-AT GACGATGAGTCCTGAGTAAAT
KRMP-CA GACGATGAGTCCTGAGTAACA
KRMP-CC GACGATGAGTCCTGAGTAACC
KRMP-CG GACGATGAGTCCTGAGTAACG
KRMP-CT GACGATGAGTCCTGAGTAACT
KRMP-GA GACGATGAGTCCTGAGTAAGA
KRMP-GC GACGATGAGTCCTGAGTAAGC
KRMP-GG GACGATGAGTCCTGAGTAAGG
KRMP-GT GACGATGAGTCCTGAGTAAGT
KRMP-TA GACGATGAGTCCTGAGTAATA
KRMP-TC GACGATGAGTCCTGAGTAATC
KRMP-TG GACGATGAGTCCTGAGTAATG
KRMP-TT GACGATGAGTCCTGAGTAATT
Rim2/Hipa CACTA  
Rim2/Hipa-MAP AGATGGTTTCTCCACCAGTG