Skip to main content

Table 2 Oligonucleotide primers used to amplify ATOX 1 coding sequences and splice junctions

From: Genomic organization of ATOX1, a human copper chaperone

Exon Forward Primer (5'-3') Reverse Primer (5'-3') Fragment Size
Exon 1 aggcgctgctgacaccgccg ttcaagatcagcatccggtc 151 bp
Exon 2 aggcttctgatgagtctgatgc tctgcatgcatctgaacatg 273 bp
Exon 3 tgagtagtaatttagagcctg aggtgttcgctctgatgagag 327 bp