Skip to main content

Table 1 New microsatellite markers and primers developed for this study.

From: Quantitative trait loci in Anopheles gambiae controlling the encapsulation response against Plasmodium cynomolgi Ceylon

Marker name Genetic (Cytogenetic) location Forward primer (5' – 3') Repeat type Reverse primer (5' – 3') Sequenced allele size (bp)
Chromosome 2      
H682 (2R, 7B) CGGGCGGTCGTTATTAGGAG (AC)7 CTGAGTTGACACGAGTTGCC 73
3F11-C1 (2R,9B) AGATGGTGTCCTTCGGTGTC (GT)17 GTGGAGGAGAAGCCACACAT 156
3B20-B1 (2L, 24B) GAGACCAAAACATGTCAACCG (CA)17 GTATGTCTGCGCATGAACGAT 122
R007 71.1 (2L, 26D) GCACCAGTCAAATACGCACT (CA)3+9 GTCCGTGTTGTTCGAAGATG 184
Chromosome 3      
H249 11.9 (3R, 30A) GGAAGCAGCTGCCTTTTATG (TG)15 ACAATGTAACACAGCGCGAG 161
3A13-12 (3R, 30E) GAACAAAACGTGCCACAGC (GT)9 TCCCCGACTTACGTGAACC 168
3A7-37 (3R, 31B) CGATTGGAACCAACAAGTGG (CA)2+9 AAGCCATCTCTTGACGTTCG 151
Ddc* (3R, 33B) CGTTGAGAACCGAAAACAGG (GT)10 ATCGGGACACTCAGCAACAG 121
3A6-17 (3R, 33C) TGTGAAGAATGTTTTCGCTGAC (AC)17 CTCCCCCGTGTAATTTGAAC 120
9D17-42 (3R, 33C) TAAACCTCACCGTCCACATC (TG)23+5 AAATTGAAACCCGTCCAAAG 150
6B10-1 (3R, 33D) CATGAGTGCCGCTGTAAATG (TG)2+16 ATCGCTCTCCTCCTCTAGCC 120
3A23-100 (3R, 34A) AATGGACCATCGTTAGCACAG (TG)12 TCCAAAGTTTTCCCTTCCAC 136
3L09-C1 (3L, 38C) GAAACTTCCCTGAATTTCCGC (CA)10+8 ATGGAGGCGACTAAACGTTGC 169
3A2-29 (3L, 41A) GGCTGCTCTAGGAGGATGTG (CT)16 AATCGAGGGTGGTGTGAATG 189
3O10-C2 (3L, 41D) TTAATCACCCACCTTGATCGC (CA)18 CCTAGAGCTTGGAATCGAATC 101
3A14-11 (3L, 43D) GTAATAGCGAGCGAGCGAAC (TG)36 GAGCGATCCGAATCGTTAGT 180
3A14-47 (3L, 43D) GGAGGCACTCTACCACAACC (GT)10 CCGAACGTCATCGCTAATG 104
3A19-32 (3L, 43D) CGTGCTGGCATTAAAAAGTG (CA)15 CTACGCATGCATCTTTCTCC 138
3A5-25 (3L, 45A) CCTTGGGCGCTATAAAACAC (TG)10 TATTAGCAGCAGGGGAAACC 131
19A18-54 (3L, 46A) TAATGCAGTGGTGCGGTTC (GT)5+6 AATCACAGCCCAGTCAGTCC 121
19C20-B1 (3L, 46B) ACCAAGTGCTCTTTGGGTTG (TG)15 ACGAATGCTGGACAATGTGA 141
  1. The cytogenetic location of H682 is A. gambiae scaffold predicted by it's location in AAAB01008987, contig 566 (GenBank accession AAAB01008987). New primer pairs were designed for markers R007 [44] and H249 [14]. Sequenced allele size is expressed in base pairs (bp). * This Dopa decarboxylase microsatellite is contained within the large first intron of predicted Ddc isoform 1. DNA sequence is from G3 strain (GenBank # AF063021; P. Romans, unpublished).