Skip to main content

Table 2 Primers and PCR conditions used for analysis of CCS gene

From: Human CCS gene: genomic organization and exclusion as a candidate for amyotrophic lateral sclerosis (ALS)

Exon Forward Reverse Product Size (bp) Annealing Temp (°C)*
1 CGCCGCGCTGGTTGGTG CGGCGAGGCTCCACACGAAG 138 57
2 CGATCATCGGTTGGT TAATAGATTCGCCTGGTC 173 51
3 CAGCCTCTGTTGCCCTCT ACCTTCCTCAAAGCCACTCC 285 57
4 CAAGCCAGCCCAAGTGTCTA TGAGGGCCCAGTGTGAAA 271 57
5 CCTGTGAGCTGCTTTCCT TCTGAGACTTTGGGTCCTCT 159 57
6 ATAGCAGCTTGGCACCAC GATGATGGACCCTGTTAGGA 184 57
7 TGGGCACCCTTCCTAACAG ACCATCCGCAGAGCACAG 201 57
8 CACCCCTGACCACACATT ATAAGGGGCATGGAGACAA 379 57
  1. *PCR conditions: initial denaturation at 94°C for 5 min; 40 cycles of denaturation at 94°C (30 s), annealing (30 s), extention at 72°C (40 s); final extension at 72°C for 7 min.