Skip to main content

Table 1 Eleven PCR primer sets that allow the amplification of the entire coding sequence and surrounding intronic sequence of the DMN gene.

From: Genomic organization and single-nucleotide polymorphism map of desmuslin, a novel intermediate filament protein on chromosome 15q26.3

Primer Primer Sequence
1F 5' - ATCCACCAAGGCCAGGACACTCGTATGCTCC
1R 5' - TCGTCCTCGTACAGCTGCAC
2F 5' - GGAGAGGACGAGACCGGGACAAGACCA
2R 5' - CGGAAATGCATGGTAAGGCTG
3F 5' - GAGCTGCAGCGCCTGGATGCGGAGGAG
3R 5' - GTTAAAGCAGCTGCCACCTAACCCCATGACGAGGA
4F 5' - GGAAACCATCCTGCAAGTGACTGCATG
4R 5' - GAGACACCTGCTCAGTGACCTAAGC
5F 5' - GGTGACACTATGGTCATTGGCCGCATACCAC
5R 5' - CCAGGGGTGTGAAACACAAGTTCAGGTGCAC
6F 5' - CACAAAAACGAGCACCTCTGACCTCTCTGGG
6R 5' - GAATGACGGTCCTCTCATTTGACCG
7F 5' - CCAACGTCAGAACTTTCTCTCCAACC
7R 5' - CCAGGCCAGCTTCATCGGAAACATC
8F 5' - GTCACTTACGTGGACAGGAAAGAGC
8R 5' - GACTGTGGGTTCGGCATGAAATTC
9F 5' - GGGCGAGCAGAGTTATTTTGTGTCC
9R 5' - CTCCATCTCACTGGCCTCATCTTTGC
10F 5' - GAGCGTTTCCGTGGATGTCAAGAAG
10R 5' - GATGACTTCTCTGGACAGTGGACTTTGACCGG
11F 5' - GAGCGTTTCCGTGGATGTCAAGAAG
11R 5' - GTTAAGGCCTTTGGATGTTGGCACG