Skip to main content

Table 4 Primers used

From: RHD positive haplotypes in D negative Europeans

Name Nucleotide sequence region Position* Strandedness specificity
ga31 ttgtcggtgctgatctcagtgga exon 3 362 to 383 sense RHD
ga41 acatgatgcacatctacgtgttcgc exon 4 503 to 527 sense RHD/RHCE
ga42 cagacaaactgggtatcgttgctg exon 4 625 to 602 antisense RHD/RHCE
ga51 ctgctcaccttgctgatcttccc intron 5/exon. 5 8 to 787 antisense RHD
ga61 caggtacttggctcccccgac exon 6 936 to 916 antisense RHD
ga62 ttatgtgcacagtgcggtgttgg exon 6 804 to 826 sense RHD/RHCE
ga71 gttgtaaccgagtgctggggattc exon 7 944 to 967 sense RHD/RHCE
ga72 tgccggctccgacggtatc exon 7 1066 to 1048 antisense RHD
rb12 tcctgaacctgctctgtgaagtgc intron 4 198 to 175 antisense RHD
rb21 aggtccctcctccagcac intron 3 28 to 11 antisense RHD/RHCE
rb24 agacctttggagcaggagtg intron 4 -53 to -34 sense RHD/RHCE
rb26 aggggtgggtagggaatatg intron 6 -62 to -43 sense RHD/RHCE
rb45 acactgttgrctgaatttcggtgc intron 1 164 to 139 antisense RHD/RHCE
rb51 gcatgacgtgttctgcctcttg intron 7 -3365 to - 3386 antisense RHD
rb52 ccaggttgttaagcattgctgtacc intron 7 -3433 to -3409 sense RHD
re04 aggtcacatccatttatcccactg promoter -2498 to -2474 sense RHD/RHCE
re08 gggcttgggacttagttctaac promoter -858 to -879 antisense RHD/RHCE
re09 cgactgggtgattaaaatctcc promoter -1280to-1259 sense RHD/RHCE
re011d gcagccaacttcccctgtg promoter -883 to -905 antisense RHD
re012 tccactttccacctccctgc promoter -1148to-1122 sense RHD
relld agaagatgggggaatctttttcct intron 1 129 to 106 antisense RHD/RHCE
re41 cgatacccagtttgtctgccatgc exon 4 608 to 631 sense RHD/RHCE
re71 acccagcaagctgaagttgtagcc exon 7 1,008 to 985 antisense RHD
re74 tatccatgaggtgctgggaac intron 7 -244 to -224 sense RHD/RHCE
re721 ctggaggctctgagaggttgag intron 7 -348 to -326 sense RHD
re83 gagattaaaaatcctgtgctcca intron 8 -54 to - 34 sense RHD/RHCE
re93 cacccgcatgtcagactatttggc intron 9 320 to 297 antisense RHD/RHCE
re93k gccaaatagtttgacatgcgggtg intron 9 297 to 320 sense RHD/RHCE
re94 cttggtcatcaaaatatttagcct exon 9 1216 to 1193 antisense RHD
re916 gtttttgaggcaaagtctcgctc intron 9 1689 to 1666 antisense RHD/RHCE
rea7 tgttgcctgcatttgtacgtgag 3' UTR 1311 to 1333 sense RHD/RHCE
rend31k cctccccaacccagacagaattag AJ252311 8506 to 8529 sense not applicable
rend9b1 cactgcacttggcaccattgag AL031432 29489 to 29468 antisense not applicable
rend9b2 ttccgaaggctgcttttccc AL031432 28840 to 28859 sense not applicable
Rh152Tb gatattactgatgaccatcctcatgg exon3 480 to 455 antisense RHCE
Rh223Vf ttgtggatgttctggccaagtg exon 5 646 to 667 sense RHCE
Rh245Vb gctgtcaccactctgactgctac exon5 755 to 733 antisense RHD
RhPsiB tctgatctttatcctccgttccctc exon 4 601 to 577 antisense RHD
RhPsiF agacagactaccacatgaacttac intron 3 -38 to-15 sense RHDψ
RhX1f1 cgctgcctgcccctctga exon 1 31 to 48 sense RHD(W16X)
rr4 agcttactggatgaccacca 3'UTR 1,541 to 1,522 antisense RHD
  1. *The positions of the synthetic oligonucleotides are indicated relative to their distances from the first nucleotide position of the start codon ATG for all primers in the promoter and in the exons including the 3' untranslated part of exon 10, relative to their adjacent exon/intron boundaries of RHCE for primers in introns; and according to the numbering in the genomic sequences indicated. Primers rh1 [44], ga31 (previously dubbed D-3-383), ga41 (D-4-527), ga42 (D-4-602), ga51 (D-5-787), ga61 (D-6-916), ga62 (D-6-826), ga71 (D-7-967), ga72 (D-7-1048) [27], rb5, rb12, rb24, rh5, rh7 [31], rb21, rb26, re11d, re71, re74, re83, re93, rr4 [32], re012 [29], re011d and rea7 [7] have been published previously. 5' UTR: 5' untranslated region of exon 1; 3' UTR: 3' untranslated region of exon 10. Accession number of nucleic acid sequence in EMBL/GenBank/DDBJ; AJ252311 represents upstream Rhesus box; AL031431 Chromosome 1 genomic clone dJ465N24.