Skip to main content

Table 1 Pyrosequencing primers and conditions used in the study

From: Detection of three closely located single nucleotide polymorphisms in the EAAT2 promoter: comparison of single-strand conformational polymorphism (SSCP), pyrosequencing and Sanger sequencing

Oligonucleotide Sequence 5′-3′ Product (bp) Annealing T (°C) Annealing T (°C)
EAAT2F GGGGCTAAACCTTGCAATCC 180 65 None
EAAT2R CTGCCACCTGTGCTTTGC
EAAT2PyroF-BIO GGGGCTAAACCTTGCAATC 166 60 5′ Biotin
EAAT2PyroR GAGTGGCGGGAGCAGAGA None
EAAT2PyroSeq1 GGGTGTGTGCGCGCC N/A None
EAAT2PyroSeq2 CCGCACACGCGCACG N/A None
Target sequence for pyrosequencing (1) T/GGGGGAGGCGGTGGAGGCCG/TCTG
Nucleotide dispensation order (1) CGTGCAGCGTGAGCGTGC
Target sequence for pyrosequencing (2) G/ATGTGTGCGCGCC
Nucleotide dispensation order (2) CAGTGTGT
  1. Primer pair EAAT2PyroF-BIO/EAAT2PyroR were used to generate biotinylated PCR products flanking SNPs g.-200C > A; g.-181A > C and g.-168C > T. Primers EAAT2PyroSeq1 (to detect g.-200C > A;-181A > C) and EAAT2PyroSeq2 (to detect g.-168C > T) were used for pyrosequencing. In the dispensation order the nucleotides used as negative controls are underlined. The nucleotide change in the Target sequence for pyrosequencing is indicated in bold.
\