Skip to main content

Table 2 List of genes surveyed and primer sequences used in the study

From: Patterns of nucleotide diversity and phenotypes of two domestication related genes (OsC1 and Wx) in indigenous rice varieties in Northeast India

Gene name Primer name Primer sequence (5′ - 3′) Functional association
Waxy [24] WxU1F GCCGAGGGACCTAATCTGC Granule-bound starch synthase
Wx1R TGGTGTGGGTGGCTATTTGTAG  
Wx2FaF GCCCCGCATGTCATCGTC  
Wx2R GTTGTCTAGCTGTTGCTGTGGA  
Wx1Fint TTGTCAGCACGTACAAGCA  
Wx2Rint GCTATATACATTTTCCTTTGACCAA  
OsC1[27] OsC1F1 ATCGCTCAGTCTCACACCGCA Anthocyanin biosynthesis
OsC1F3 GAGGGA GAATGGGGAGGAGAGC  
OsCF4 TAATTGTGATCTGTATGGATGCTG  
OsC1F5 GATCGATCGTGTATATATGTTGTCAGGT  
OsC1R6 GTTGCTGTGTCGGTGT CGGCG  
OsC1R7 ATGGCCGTCTCCTAATTCCCCTGC  
OsC1R2 CGTACGGACGACGAACTAATGTCAC