Figure 2From: PSPHL and breast cancer in African American women: causative gene or population stratification?PCR detection of deletion or insertion of PSPHL gene. The forward primer that detects the deletion allele spans the deletion breakpoint on chromosome 7p and the primer pair amplifies a 793 bp fragment. The primers that detect the insertion product amplify a 208 bp fragment from exon 1 of PSPHL. Genotypes shown here are A = del/del, B = del/del, C = ins/del, D = ins/ins, and E = ins/del. Primers used are (all in 5′-3′ direction - insertion forward: AGGCTCCCTGGCTGGC, insertion reverse: CAGGCTCAGGTGAGGCG, deletion forward: AAGCCAGTGCGTCTACAGGTG, deletion reverse: GTGCCAGAAGAACCACACAGTC.Back to article page