Skip to main content
Figure 2 | BMC Genetics

Figure 2

From: PSPHL and breast cancer in African American women: causative gene or population stratification?

Figure 2

PCR detection of deletion or insertion of PSPHL gene. The forward primer that detects the deletion allele spans the deletion breakpoint on chromosome 7p and the primer pair amplifies a 793 bp fragment. The primers that detect the insertion product amplify a 208 bp fragment from exon 1 of PSPHL. Genotypes shown here are A = del/del, B = del/del, C = ins/del, D = ins/ins, and E = ins/del. Primers used are (all in 5′-3′ direction - insertion forward: AGGCTCCCTGGCTGGC, insertion reverse: CAGGCTCAGGTGAGGCG, deletion forward: AAGCCAGTGCGTCTACAGGTG, deletion reverse: GTGCCAGAAGAACCACACAGTC.

Back to article page