Skip to main content

Table 7 Penstemon SNP marker name, GenBank dbSNP accession ID, polymorphism type, KASPar™ primer sequences (A1, A2 and common allele specific reverse) for all 75 functional SNP assays

From: Developing molecular tools and insights into the Penstemon genome using genomic reduction and next-generation sequencing

Name Contig Source1 SNP Allele GenBank Accession #2 SNP Type Allele Specific A1 Forward (5′→3′) 3 Common Allele Specific Reverse 5′→3′) P. davidsonii P. cyananthus P. dissectus P. fruticosus P. pachyphyllus P. cyananthus + P. davidsonii P. dissectus + P. davidsonii
Allele Specific A2 Forward (5′→3′) 3
PenSNP00001 00336CD JX649978 A/G AAGATTGCATGGAGAGGAAATGGATT CGATCCAAATGGCAGATCCGAGAAA X4 Y X   X Y Y
AGATTGCATGGAGAGGAAATGGATC
PenSNP00002 00405CD JX649979 C/T ACGCGAGTAATAAGTTGGTTTTCTTC CCAACACTTCCGCAGAAGCTCTTAA Y X Y X Y H H
GACGCGAGTAATAAGTTGGTTTTCTTT
PenSNP00003 02625CD JX649980 A/T AAAAGCTCCCAAACATGACTATGAACT AATTCTTCGACACTTGAAGAGAGCGTAA Y X Y   Y H H
  AAAAGCTCCCAAACATGACTATGAACA  
PenSNP00004 02857CD JX649981 A/C ATCAAATGAACTTGTCTCATGAGCCT GCAACAAGGTGCAAAAAATTGTAGCGTAA X Y X   X H H
  CAAATGAACTTGTCTCATGAGCCG  
PenSNP00005 03943CD JX649982 A/G ACTACCAAAACTACCCTTCCCTTA GGGGTACAGAGTTGAGAAGAAGGAA X Y X   X H H
  ACTACCAAAACTACCCTTCCCTTG  
PenSNP00006 04420CD JX649983 A/C TGTCTCTAAATCGATATGATGAGGCT GTGGTTCTTCCCCTTTAGAGGACTT Y X Y X Y H H
  GTCTCTAAATCGATATGATGAGGCG  
PenSNP00007 08446CD JX649984 A/T GGCAACATCCTCAGCAGAGACA CCGACTCCCTTAGCAATCTTAGCAT Y X X   X H X
  GGCAACATCCTCAGCAGAGACT  
PenSNP00008 11303CD JX649985 C/G GGGTGGTATTGGTTACTTTTATGGG CGGTATAAGAGCAACTAAGCTAAATGACTT Y X Y   Y H H
  GGGTGGTATTGGTTACTTTTATGGC  
PenSNP00009 11357CD JX649986 C/T ACAATATTTGATAATTCATTCTCAAGTGCG AAGCATGCAGTGAGACAAAAGCTAAGAT X Y X Y X H H
  CACAATATTTGATAATTCATTCTCAAGTGCA  
PenSNP00010 11935CD JX649987 A/C AGCCTGATTATCCCTTAAACCCAATT GAATCACGGCGGGGGAGCAAAT X Y X   X Y  
  GCCTGATTATCCCTTAAACCCAATG  
PenSNP00011 12047CD JX649988 C/T TTTGGCACTGCAGTGACCATC TGCTCCAGTCCGAAGGAAGTTGAAT X Y Y   X Y Y
  CTTTTGGCACTGCAGTGACCATT  
PenSNP00012 12119CD JX649989 A/G AAGATAGACGTGGTATTTCTTCAGCA GCAATTAGTCACAGACCATAGTGG X Y X   X H H
  AGATAGACGTGGTATTTCTTCAGCG  
PenSNP00013 12398CD JX649990 A/T TATTTTCCTTTCTGCAATCTCAACATTGA GTTGAGTGTGATTTTAGAGTGCATTTAGTT X Y X   X Y Y
  ATTTTCCTTTCTGCAATCTCAACATTGT  
PenSNP00014 13398CD JX649991 A/C AGGCCTGTGGCTGACTTGTCA GGCATATCTTTGCCCGTTTCCACAA X Y X X X H H
  GGCCTGTGGCTGACTTGTCC  
PenSNP00015 13752CD JX649992 A/C AAATGCTCCCTCATTTTGACCATATGA GTCAACGGATTTGTGGAAGTCGGTA Y X Y   Y H H
  ATGCTCCCTCATTTTGACCATATGC  
PenSNP00016 14394CD JX649993 C/G TGAAAATTTCAGATTTAATGAACAAACAGTC AGACTTGTAACAAATTCCTTGGGTCCAAA X Y X    Y H
  GAAAATTTCAGATTTAATGAACAAACAGTG  
PenSNP00017 14661CD JX649994 A/G TGACCAAGGAATCTGTTCAAGAACTT CTTCTACTGTGGCTGTTTCACCTCTA Y X Y    H H
  GACCAAGGAATCTGTTCAAGAACTC  
PenSNP00018 15226CD JX649995 G/T TACCTCCAATTGTGATGCAACATTAG CTAAGTGAGAAGCACAAGGA X Y X   X H H
  CTTACCTCCAATTGTGATGCAACATTAT  
PenSNP00019 17421CD JX649996 G/T ATCCTCCTCCTTTGCATCAAAGC GAGCCAACCTCGACTGCTTCTATTT Y X Y   Y X H
  CATCCTCCTCCTTTGCATCAAAGA  
PenSNP00020 17816CD JX649997 A/G AAGGACTGAGTACCAAGACAGATCT GCCAGGGTACTGAACCTGTCTTTTA X Y X   X H H
  GGACTGAGTACCAAGACAGATCC  
PenSNP00021 18745CD JX649998 C/T AGCATATTGAAAAGATCAGTCGCATAG CAGCTGCTCCTATCCAATCTTCGAA Y X Y   Y H H
  AAAGCATATTGAAAAGATCAGTCGCATAA  
PenSNP00022 19267CD JX649999 A/G AAATACCTGAGCTTCTGCCTCTTGT GATGCTCGTCATCTTGCTCAACGAT X Y X Y X H H
  ACCTGAGCTTCTGCCTCTTGC  
PenSNP00023 21409CD JX650000 C/G ACCATTCAGGTAATATTTCCAAAGGC AGCGGTTCTAGAACCGTCAATGCTT Y X Y Y Y X H
  ACCATTCAGGTAATATTTCCAAAGGG  
PenSNP00024 22934CD JX650001 A/G GTACAATTGTCAAGTGTGTATTTTCTTACATA GCACTGCACCATTCATGCCCTAAAA Y X Y   Y H H
  ACAATTGTCAAGTGTGTATTTTCTTACATG  
PenSNP00025 22942CD JX650002 A/T ATCCGATTCTTCGTCTACTATGCCA AGAAAAGCACAAGCTGAAATCAGGGAA X Y X   Y H H
  ATCCGATTCTTCGTCTACTATGCCT  
PenSNP00026 27992CD JX650003 A/G TCCTCCTCGTCTCTTCCTCTT CTTGGACCGTCCAAAGAAGGAAAGAA Y X Y   Y H H
  CCTCCTCGTCTCTTCCTCTC  
PenSNP00027 01179DD JX650004 A/G TCGACCCCAACCTGTCACA CTTGCTTGGTTTCGGAAAGAG Y X Y   Y H H
  CTTCGACCCCAACCTGTCACG  
PenSNP00028 01235DD JX650005 C/T TGTGATCTTTGGTTTGAACTTTGTC CTACCAAACTCACTCTAACATCCGGAT X Y X   X H H
  CACTTGTGATCTTTGGTTTGAACTTTGTT  
PenSNP00029 01600DD JX650006 A/G TGGTCTTGTTCTTTACCATTACGCAT GAAGTAGCTGCCATGGAAAAGGAAGTT X X Y X X X H
  GGTCTTGTTCTTTACCATTACGCAC  
PenSNP00030 04630DD JX650007 A/G AGTAGTACAGAATACTTAAAACTATCACCA GTTGGGGGAGTTGCCTTCTTGAAAT X X Y   X X H
  GTAGTACAGAATACTTAAAACTATCACCG  
PenSNP00031 05304DD JX650008 C/T AGTTTTCCTTTTGTCCTTATGTGCAG AAGGCTTAGCTTGGATGATATCCTACAA Y Y X   Y Y Y
  CAGTTTTCCTTTTGTCCTTATGTGCAA  
PenSNP00032 05884DD JX650009 A/T GTCACCGCCTCCGATTGAGATT CGGCTTTTGACGCCGCCGTAAA X Y X   X H H
  GTCACCGCCTCCGATTGAGATA  
PenSNP00033 06956DD JX650010 G/T GTTGATTCTACAGATCTTAATTCTTGATTG TACTACAAAGGGTAAAAAGTGCAATTCATA X Y X   X H H
  AGTTGATTCTACAGATCTTAATTCTTGATTT  
PenSNP00034 08307DD JX650011 C/G ACATTAAGGGTCCACCAAAAATCCG GCGCAATTAAAATCTCTTAAATCACCTGGT Y Y X    Y H
  ACATTAAGGGTCCACCAAAAATCCC  
PenSNP00035 08352DD JX650012 A/T AGTACAAGGAAAAACCTTTTATTAGTAAGTATA CTGACACAAACCCATTCTAATATGACCAA X Y X   X H H
  AGTACAAGGAAAAACCTTTTATTAGTAAGTATT  
PenSNP00036 08488DD JX650013 A/T GTGTTGGAGAGCCAGGTGCGA GTATTGAGGATCATTCTGACAAAAAACATA Y X Y   Y H H
  GTGTTGGAGAGCCAGGTGCGT  
PenSNP00037 08608DD JX650014 C/T GTAGATAAGTTGATTGCGAGAGGC CCAAACAAATGCACCACATTCTCCTT X Y X Y X Y H
  GGTAGATAAGTTGATTGCGAGAGGT  
PenSNP00038 08831DD JX650015 A/T TTTGAACTGCCATGTAAAGTTGTTTTAGA ATTTTGAACCAAGGAGCTATCAGAGG X Y X   X Y H
  TTGAACTGCCATGTAAAGTTGTTTTAGT  
PenSNP00039 08947DD JX650016 A/T GGGATCGTAAAACTCAGGAAAAATGA TCAGATACTCGTGGGGTCTTCGATT X Y X H X Y H
  GGGATCGTAAAACTCAGGAAAAATGT  
PenSNP00040 08959DD JX650017 A/G AGAGAATGAAGAAGGAGAAGGAAGAAA CTCCTACGGTTGCATTATCGGTAGTA Y X Y   Y Y Y
  GAGAATGAAGAAGGAGAAGGAAGAAG  
PenSNP00041 09272DD JX650018 A/T TTCTACAAAACAATCAGCAGTCATCATT TCGACACCTTTTGCCTTATCTTGAA X Y X   X Y H
  TCTACAAAACAATCAGCAGTCATCATA  
PenSNP00042 09369DD JX650019 C/T GTTTTTATACGCATCCATATACATAATAATAG GGTTCACTCTCCAGAAATAAAATCTTATAT Y X Y   Y H X
  GTTTTTATACGCATCCATATACATAATAATAA  
PenSNP00043 09764DD JX650020 A/G AATTCAACGTCAAATTGCAAGGTTGCA TTCACTATACCGGCTGAGTTGGCAT Y X Y   Y H H
  CAACGTCAAATTGCAAGGTTGCG  
PenSNP00044 10765DD JX650021 A/G TTTTTTAATAAATATCCTGGTGGATAATTTAT AAATTGAGTGGATGGCTAGGAAGACTAA X Y X Y X H H
  TTTTTAATAAATATCCTGGTGGATAATTTAC  
PenSNP00045 10870DD JX650022 A/T AGATCTGGAGACTAAAT CGAAGAGTTTGGGTGGGCGGAT X Y X   X Y Y
  AGATCTGGAGACTAAAA  
PenSNP00046 11107DD JX650023 C/T GTCCGACGTGACAATGCAGC CGCCGTCAAAGAGACTTTGTTGGAT Y X Y   Y H H
  CTGTCCGACGTGACAATGCAGT  
PenSNP00047 11531DD JX650024 C/T AGAAGATTCTTCGGCTGGGAGC TCTTCACATGATTACGACAATGGCTGAAT X Y X   X H H
  AAGAAGATTCTTCGGCTGGGAGT  
PenSNP00048 11655DD JX650025 A/G ACGTCCATGGAGGACCATAAA GCTGTCTTCCTGCAAGGAACTTCTT X Y X   X H H
  CTACGTCCATGGAGGACCATAAG  
PenSNP00049 11974DD JX650026 G/T AAAATGCATGTAGTTTGGTTTACG CACACCCCCAAAGGAAGAATAGCAT Y X Y   Y H H
  AAAATGCATGTAGTTTGGTTTACT  
PenSNP00050 13159DD JX650027 C/T TGAATGTACTTTTCATTGATAGAGAACG AACAATAGTACAACACAACTAAAGCAGAGA Y Y X   Y Y H
  GTTGAATGTACTTTTCATTGATAGAGAACA  
PenSNP00051 13463DD JX650028 G/T GCCTTTGACGGCGAAGGATTTC GCAAGCACGGCACTAAGCCCTT X Y X   X H H
  CGCCTTTGACGGCGAAGGATTTA  
PenSNP00052 14334DD JX650029 A/G AGAAACAACAAATACGAATAAATCACCCA TTCGAAAATTGTGCTTGAATCACGCAGT X X Y H X X Y
  GAAACAACAAATACGAATAAATCACCCG  
PenSNP00053 00290DD03373CD JX650030 C/T TGCCTTTGCGTCGCCACAATC AGCTAAGAGATGGGCAGACTTTACAAAAT Y X Y   Y H H
  CTTGCCTTTGCGTCGCCACAATT  
PenSNP00054 00354DD04637CD JX650031 A/G GCAAAAGGGAACCCTCATTTCGTT TACTTGTCTGGGACTTTTCCTTTCTCTTT X X Y   X X H
  CAAAAGGGAACCCTCATTTCGTC  
PenSNP00055 01161DD11697CD JX650032 A/G ACTGGTAAATACACTACGTTCACAGT GAAACACAGCAGCCCAACGACATAT Y Y X X Y Y H
  CTGGTAAATACACTACGTTCACAGC  
PenSNP00056 01323DD15501CD JX650033 A/G ACCTGAAGAATTTGTTCACTACTTCGT GGATCGGGTGGAACGATTTGTGTT X Y X   X H H
  CCTGAAGAATTTGTTCACTACTTCGC  
PenSNP00057 01541DD02481CD JX650034 A/G AATTAGAACCACATCCACTGATTCCAA GGAGCCCAAACCTTTTACATTCTTTTCTA Y X Y   Y H H
  AGAACCACATCCACTGATTCCAG  
PenSNP00058 02019DD03127CD JX650035 A/G GTGATTGTTAAATCTGAATATATAATTTCTTTT GTACGAGGCTTCGAAAAAGACCAGAT X Y X   X H H
  GTGATTGTTAAATCTGAATATATAATTTCTTTC  
PenSNP00059 02851DD17191CD JX650036 A/G AAGAGGTTGATCCTAAGTTATCGAGA GAAGAAAATCATTGTCCACATCTCGTGTA X Y X   X Y H
  AGAGGTTGATCCTAAGTTATCGAGG  
PenSNP00060 03089DD14703CD JX650037 C/T TTTCAGAGTCACTAATGTTCTCACG GCATTTCTTGTCCATCTCTTCAAGATGTA X X Y Y X X H
  GTTTTCAGAGTCACTAATGTTCTCACA  
PenSNP00061 03423DD25897CD JX650038 A/C AATTCTTCTACGTCCATTTGATCGGAT TATTCTTAGACATGGACATGGAAATTGAGA Y X Y   Y H H
  CTTCTACGTCCATTTGATCGGAG  
PenSNP00062 04632DD19186CD JX650039 A/T AAATGGGTCAGCTGAAATTTCCGCA CTCTTCTTTACTCTGTTTTTTCTTCTTTTT Y Y X    Y H
  AAATGGGTCAGCTGAAATTTCCGCT  
PenSNP00063 05160DD08243CD JX650040 C/G TCGATCGTTGAAATGATAATTGATACAAG GATCCCATAGACTTCTTTTAAGGATTCTAA Y X Y Y Y H H
  CGATCGTTGAAATGATAATTGATACAAC  
PenSNP00064 06332DD03627CD JX650041 A/C ATCAAATGCCATAGATCCTGCAGATTT ACATTTCCTACACCAACTTCTTCCACTA X X Y   X X H
  CAAATGCCATAGATCCTGCAGATTG  
PenSNP00065 08748DD13630CD JX650042 C/G AGCTGTTCAGGAGGTTCATGAATG CACCATGTGAACCAACACTATTGTCATTT X Y X   X H H
  AGCTGTTCAGGAGGTTCATGAATC  
PenSNP00066 09773DD14323CD JX650043 A/G TCATGCCCATTCCCCA CCTGGTATGAACATGGGGAGGTTAT Y Y X   Y Y  
  CATGCCCATTCCCCG  
PenSNP00067 10248DD06150CD JX650044 C/G TGTGTCATTGAAATCAATCCGC GTTTCATATCTCCCTTTGAGCTTCTTGAA Y Y X Y Y Y H
  GCTTGTGTCATTGAAATCAATCCGG  
PenSNP00068 10624DD11358CD JX650045 A/G GTGGCAGTGTGAAACTGCATCA GTTTTTCCCTGGGTGCTAAGGTTCAT Y X Y   Y H H
  GTGGCAGTGTGAAACTGCATCG  
PenSNP00069 11267DD06273CD JX650046 A/C ACCAAATACTTATTAGCTCCAGTCGAA GACTGAAGGATGTTGCGAGAGGC Y Y X   Y Y H
  CCAAATACTTATTAGCTCCAGTCGAC  
PenSNP00070 11564DD17128CD JX650047 C/T TGGACTTGGCATTGAAACAAAAGATC ATATGAAACTCCCCACAAGAAA Y X Y   X H H
  AATTGGACTTGGCATTGAAACAAAAGATT  
PenSNP00071 11647DD17264CD JX650048 C/G GCACGAGCCAAAATCCTGAGC ATTGGCATGTGTATCCTGTGTGGGA X Y X Y X H H
  GCACGAGCCAAAATCCTGAGG  
PenSNP00072 11671DD17144CD JX650049 C/T GTGCAGCAACCCCTATTCATGAC CCTGTCCAAAACATATGATCTTCATTGGAA X Y X    H H
  ATGTGCAGCAACCCCTATTCATGAT  
PenSNP00073 12915DD17470CD JX650050 A/G AAGAAAAGGGTGGACAAATTAAACCGT CAGAACAACATCATACTTGATAAATCTCTT X X Y   X X H
  GAAAAGGGTGGACAAATTAAACCGC  
PenSNP00074 13828DD14937CD JX650051 C/T GTAAGATATGCTGCCAGATGG CTCTGAAGAAGTTTTTGTCCTTGATAGCTA Y Y X   Y Y H
  GTAAGATATGCTGCCAGATGA  
PenSNP00075 14286DD18608CD JX650052 G/T GTATTGAGAGCCACTACCGG CCACTTGAATTGTTTGAAGAGTTTGGGAA Y X Y   Y X H
  CTGTATTGAGAGCCACTACCGT  
  1. 1These contigs have been deposited at DDBJ/EMBL/GenBank as a Whole Genome Shotgun project under the accessions AKKG00000000 (P. cyananthus), AKKH00000000 (P. dissectus), AKKI00000000 (P. davidsonii), and AKKJ00000000 (P. fruticosus). The version described in this paper is the first version for each accession, XXXX01000000.
  2. 2The GenBank accession identification for the full sequence for each allele with the specific SNP bp identified.
  3. 3KASPar™ primers: A1 and A2 primers are SNP allele specific. All A1 Forward primers had the follow universal primer GAAGGTGACCAAGTTCATGCT added to the 5′ end of the allele specific sequence. All A2 Forward primers had the follow universal primer GAAGGTCGGAGTCAACGGATT added to end of the 5′ allele specific sequence.
  4. 4H = heterozygous compared to either homozygous condition for either “X” or “Y”.