Skip to main content

Table 3 Summary of marker characteristics including the primary SSR motif identified in the original GR-RSC (genome reduction using restriction site conservation) sequence, primer sequences, EFL (expected fragment length), total bands, and fragment sizes

From: Developing molecular tools and insights into the Penstemon genome using genomic reduction and next-generation sequencing

Marker name1 Primary motif Forward primer (5′-3′) GenBank accession ID EFL Total unique bands Fragment size
Reverse primer (5′-3′) P. cyananthus P. davidsonii P. dissectus P. fruticosus
PS003 (di,f) (AT)8 TGCCTCTGTCTTTACATTCCAA JQ966997 217 3 360 260 250 260
CATGAAGCACTGCAAATCCA
PS004 (da,f) (ATT)6 TGTTTCAATTGCTGTCCACAT JQ951613 476 3 420 460 440 460
TTGTCTGTCCAAACGGTAGGT
PS005 (c,di,f) (GAA)6 GCCCAACTTCCGTAATTGAA JQ966998 303 3 260, 300 260 280 280
  AACTGCTTGCCACTCGACTC  
PS009 (c,da,f) (TGA)6 ACCTCGAACTTGACGGTCC JQ966999 466 4 370, 650 540 650 600
  TTCTGAGGAGAAACCAAGGG  
PS011 (da,f) (GA)8 AAGTGCGACACTGGATGTCTT JQ951614 435 2 860 500 860 500
  GCAGCTTCAGCTCCAGAAAT  
PS012 (c) (TA)8 TCCATATTGTAACCAACAATGACTG JQ951615 402 3 400 360 370 360
  TGAATGGCAAACCGTAATCA  
PS013 (f) (TA)8 GAAGAATTGATTTAAACAAGATGCAA JQ967000 399 2 400 650 650 400
  TCAGTACGTGAGAAACTTGATCAATAA  
PS014 (c) (TGA)6 CGATTTGGTATAGTTGGATTACGA JQ951616 409 3 410 370 380 410
  CCTTCATCACCCGGTACTTG  
PS015 (di) (TCG)6 GCCGAGTTTCAAGAAAGCAA JQ967001 409 2 490 500 490 490
  AATTACGACCTGCCACGC  
PS016 (c,di) (CT)8 CATGGCCCTTTCTTCACACT JQ967002 447 3 NM2 1,100 1,060 1,030
  GACGCGGTTGGCTATACAGT  
PS017 (da,di) (AG)9 GAAGGCTTAGCATAAATCCTCAAA JQ951617 455 2 750 700 750 700
  ATTAGGCTCCCACGAACAAA  
PS019 (c,di) (AG)8 AATCCCACAGCCCATACAAA JQ967003 473 1 380 380 380 380
  TGAATTGAGTCCTATACCCTATTTCAA  
PS021 (f) (CT)8 CTTTAGCTTAGCTGGAATACACGTT JQ967004 386 3 350 450 450 420
  AGATTCTTGCATCACAGTTCAATTA  
PS023 (da) (AG)8 GCTGGAGAATAACATGGCG JQ967005 469 4 310 480 120, 740 480
  CCATCTTGCAAGTCCATACG  
PS024 (da,f) (CTG)6 CTTCTTGCCCTGTGCCTCT JQ967006 403 2 430 430 400 430
  CCACCACCAACAACAACAAC  
PS025 (c,di) (TC)9 GCACATGAATGAAGGAATGC JQ967007 440 3 440 410 440 400
  ACGATCTGTGAAGGAACCCA  
PS026 (c,da,di,f) (CTT)6 ACTTAATAATGCCTCCTTGTGTCA JQ967008 465 1 460 NM 460 460
  TTCCGCAACGTTGTATTTGA  
PS028 (di) (AC)9 GGGAGGCAGGTAACAACAAA JQ967009 316 4 950 400, 460 320 400, 460
  TACCTCTGCCGAACTGGATT  
PS029 (di) (TA)8 ACCAAGTTGTTGGATGTTTGG JQ967010 440 3 840 500 500 420
  GGTTTGGAATGAGACTTAGAAGGA  
PS032 (c,di) (GT)9 ACAAAGTCTCCTCAATCGCC JQ951618 328 2 370 370 370 340
  GCATGTACCGTGCACACACT  
PS034 (c) (AC)9 CCAAACAAATCAAACAGCACTC JQ951619 322 5 310, 340 320, 950 320 360
  CATGCGAATCAGTGTTGCTAA  
PS035 (da,f) (TC)9 TTGCACAGCTACTTTGGCAT JQ951620 486 3 630 520 920 520
  ATCTGTCCAAGGCATGGAAT  
PS036 (c,di) (TA)8 TTCCTAATTTGGTAGCTGCAATC JQ967011 405 3 770 770, 820 590 770
  TCCGAGGAACTATTGCCATT  
PS038 (c,da) (TA)8 GTAATTACTTCGGCAGTTTGTTAATTT JQ967012 100 1 NM 100 100 NM
  GGTGCGACCTAATTACGTTTCTAT  
PS040 (da) (CA)9 TAAAGAGGCTTAAGCGCGG JQ967013 399 3 380 390 410 390
  ACCTGAAGAGCTGCGGAGTA  
PS041 (c,da,di,f) (AT)8 TTTCCGCAAGAGAAGAGCAT JQ967014 249 3 270 670 270 240
  CTTGTGCACGATTCCATTGT  
PS045 (c,da) (CT)8 GCCACATACATGAAACGTGAA JQ967015 366 4 460 NM 440 120, 400
  CGAACTCTCTTGTGTTTCTCCC  
PS047 (c,di,f) (AC)8 ACACGACATCGTTTCAGCAA JQ967016 428 3 470, 510 440 470 470
  GCGTATGGAGAGATTTGGGA  
PS048 (c,di) (CA)9 GCATTAGATGCCGAAATATCTACAA JQ951621 436 3 420 440 380 420
  TGCCTGTAGGTTGATTTCCTTT  
PS049 (c,da,di,f) (AG)8 CCCATCAATAAAGAAAGAAAGAAAGA JQ967017 436 2 460 460 1,000 460
  GGTGAAACCCTGTCCTAAACC  
PS050 (c,di) (AT)9 GTGTAACCTCTGAACAAGTTTACTGAA JQ967018 434 2 480 460 480 460
  TGCAGTGAGCCATGCTATTC  
PS051 (c,di,f) (TG)8 TGTAACACGACAATTTAACTCTTTCA JQ967019 352 1 280 NM 280 280
  CGAGAACTCTTTCCGAGAACC  
PS052 (c,da,di,f) (AC)9 CGCGGTCAATCTTGAAATCT JQ951622 206 1 220 220 220 220
  TGACTTCCTCTCTCTCTCTCACAC  
PS053 (di) (AC)8 AATCATAGTCTCGAGCGCGT JQ951623 410 3 160, 320 320 320, 450 320
  GAGATAAATTAGATCAGCGCATCA  
PS054 (c,da,f) (GA)8 TCGTTAAGCAATCTCGGAGC JQ967020 192 3 200 200 180 190
  TCGACTGGAGAGCAAAGCA  
PS055 (f) (AG)8 TGTGGTCCGGTTCCATAAAC JQ967021 412 4 960 500 1,040 470
  TTTGTCTCCCTAATATGTGTGATGAT  
PS056 (da,di) (TG)8 CATGTTTCAGGATTGGGCTT JQ967022 319 4 690 450 230 340
  CGGTTACACACAGGTTGTTGA  
PS057 (da,f) (AT)8 TGCCTAATGGACCTGATCCT JQ967023 402 2 570 440 570 440
  CCCAATTGTTTGAAGAAAGAACA  
PS058 (da) (AT)9 GTGCAACCAATGCAACTAATTC JQ967024 469 1 NM 720 NM 720
  TCTCTCATTTCCAATGATTTCTCA  
PS059 (di) (CT)8 CATCAATTGACACACAAGCAGA JQ967025 312 2 930 340 340 340
  TCGAATCTTAAAGAAACACATCCA  
PS060 (c,di) (AC)9 CCATGAGAAGTAGATGACTGGGA JQ967026 484 2 560 560 560 540
  TTGTAATTATGATTAACTTCCCTCGTT  
PS061 (da,f) (TA)8 CGACCAATCATCAACCAACA JQ967027 453 3 480 480, 530 450, 480 NM
  GACGGGCAGAATAATTGGAA  
PS062 (c,di) (TA)9 TGGAGAGGGTACGAAAGTGC JQ967028 320 2 350 290 350 290
  CAACGATCGATTATTAGCACCA  
PS064 (c,da,f) (AG)8 ATGGATGCCCTATGGGTACA JQ967029 437 4 490 500, 680 470 470
  TGAAATGGAGGGAGTAATATAAACAA  
PS066 (di) (GA)9 CAAGGATGCAGGCTCTCATT JQ967030 434 2 250 480 250, 480 480
  CTCTGCTCGTCGTAGTGCAA  
PS068 (c,da,di,f) (GA)8 TTTGGGATGCATTTCTCCAC JQ967031 463 2 500 500 480 480
  TCAAAGTGACATCTTCCAACAAA  
PS069 (di) (GT)8 CATTGGGTCAGATTTGGCTT JQ967032 309 4 220 210 390 350
  GCTTTCAGTTTGTATATTTGTGCC  
PS071 (c,di) (AT)8 AAGATGGCCCTGATCTGTTG JQ967033 446 1 NM NM 490 NM
  TTCGTGGGAGTTGCAAATTA  
PS074 (c,da,di,f) (AAG)6 AGAAATCTCGCTCTCCACGA JQ967034 168 1 170 170 170 170
  CGACAACCTTAGTGATCGCTTT  
PS075 (c,da,di,f) (TA)8 CACCACTTTCGCAGCATTTA JQ951624 120 2 160 140 140 140
  CAAATTACATTATTGTATGGAAACACG  
PS076 (c,di) (GTG)6 CTGACAGCAACATGAACATGAA JQ967035 161 1 170 170 170 170
  CAATCTTTGCCAATTTCCCA  
  1. 1 Parentheses indicates the species possessing sequence from which primers were designed (c = P. cyananthus, da = P. davidsonii, di = P. dissectus, f = P. fruticosus).
  2. 2 NM = no marker.