Skip to main content

Table 2 The four multiplex identifiers (MID) barcodes (adapter) primers used for the genomes of Penstemon cyananthus , P. dissectus , P. davidsonii , and P. fruticosus

From: Developing molecular tools and insights into the Penstemon genome using genomic reduction and next-generation sequencing

Species MID ID # EcoR1 MID primer1 Bfa1 MID primer2
P. cyananthus MID 1 5′- ACGAGTGCGTGACTGCGTACCAATTC 5′- ACGAGTGCGTGATGAGTCCTGAGTA
P. dissectus MID 2 5′- ACGCTCGACAGACTGCGTACCAATTC 5′- ACGCTCGACAGATGAGTCCTGAGTA
P. davidsonii MID 3 5′- AGACGCACTCGACTGCGTACCAATTC 5′- AGACGCACTCGATGAGTCCTGAGTA
P. fruticosus MID 4 5′- AGCACTGTAGGACTGCGTACCAATTC 5′- AGCACTGTAGGATGAGTCCTGAGTA
  1. 1 The “AATTC” at the 3′ end the primer was where adapters complement the enzyme EcoR1 cut site and the preceding “C” is where the base was changed to avoid further enzymatic cleavage of the fragment.
  2. 2 The “TA” at the 3′ end of the primer was where adapters complement the enzyme Bfa1 cut site and the preceding “G” is where the base was changed to avoid further enzymatic cleavage of the fragment.