Skip to main content

Table 1 Primers in this study

From: Splice variants and promoter methylation status of the Bovine Vasa Homology (Bvh) gene may be involved in bull spermatogenesis

  Gene GenBank ID Primer sequence (5′-3′) Annealing temp (°C) Product size (bp) Application
P1 Bvh AF541971 F: GAAGATTGGGAAGCAGAAA 58 1457 cDNA clone
R: CTGACGCTGTTCCTTTGAT
P2 Bvh AF541971 F: AACAGGCATAAACTTTGACA 59 1525 cDNA clone
R: GGGTGGGAGTAAGAACAGA
P3 Bvh-FL AF541971 F: TGCCTCTGGGAGGAGTTTGG 60 294 Real-time-PCR
R: GGCAACCTCGGAAACTACC
P4 β-actin NM_173979 F: CGGACTGTTAGCTGCGTTAC 60 164 Real-time PCR
R: CACCTTCACCGTTCCAGTT
P5 Bvh JX437185 F: AAG GTA AGA ATC TCC CAC TC 58 337 PCR-RFLP
R: GTC CTT GGC ACT TTC TAC AC
P6 Bvh-V4 JX437188 F: AGATCCTGGTTTTTCAAATAAC 60 193 Real-time PCR
R: GCAACCTCGGAAACTACCT
P7 Bvh-V45 JX437189 F: CGTCAGATCCTGGTGAGTCT 60 83 Real-time PCR
R: TCTGTTTCCAAAACTCTTT
P8 Bvh NW_003104511 F: GGATTGTAGTAGGTAAAAAAAGGAGA 53 346 Bisulfite sequencing PCR
R: TCCAACAACAAATAACACCAA