Skip to main content

Table 1 New SSR loci developed for Paspalum

From: Genetic variation in polyploid forage grass: Assessing the molecular genetic variability in the Paspalumgenus

Locus name Repeat motif Ta(°C) Product size(bp) NM PIC F(5´-3´) R(5´-3´) GenBank accession number
PN02-B3 (GT)12 50 139-157 11 0,8 CAAACAATGGGACAACACTT TTTTTCTGCTCTGGCTCAT HQ585421
PN02-C6 (TG)8 51,4 139-145 4 0,3 TTCAGCAATCAAGAGTTAGA AGAGACGATCAGGGTGTG HQ585422
PN02-G3 (GT)9 60 294-302 5 0,6 GTCGCCGGTCGCAGTCG CACATAGCCGGCCTCCTCTC HQ585423
PN02-G7 (AC)7 TOUCHDOWN 118 7 0,7 TGCAGCATGTAATAACC TACACAGGAAGGAAGAAA HQ585424
PN03-C7 (GT)6. 50 159-165 3 0,6 TCATGCCACGAGAAAGAAACCA CAGGGACGACAGGGACAAGACT HQ585425
PN03-D10 (GT)11 50 280-300 7 0,7 GTTATTCCTTCACTCACTCACC AGCTTTCTGCCTTCTTTTT HQ585426
PN03-D12 (AG)10 50 220-240 7 0,7 TGGGGAAGCAGGAAGTCACA CAGCTCACCGATGGGAATG HQ585427
PN03-E7 (GT)9 TOUCHDOWN 298 7 0,7 CATGCTTTTCTGCTTCC GCTAATACTGCTTGCTCTTC HQ585428
PN03-F1 (CA)7 50 184-192 5 0,7 CAGTGACCAAGCTTACAACCTA GTGGCATGCCTTTCTACAA HQ585429
PN03-F10 (TG)7 60 165-177 7 0,8 TGCCTACCGTTTCCTCTTCTCT GGGATGGGTCTTGACTCTTGAT HQ585433
PN03-F3 (GT)8 60 165-203 8 0,8 ACCCCGCGTCCTCTTTCTCA CCCAACCCACCATTATCCTCTG HQ585430
PN03-F7 (CA)10 50 200-212 6 0,8 TGCTGGCAGTCTTTCTCT GGCCATACCACTTTTTG HQ585431
PN03-F9 (CA)8 60 179-275 15 0,9 AAAAGGGCAGGAGTTAGGAC AGTTGGCTCAGTTACGATTTTA HQ585432
PN03-G5 (CA)7 60 126-138 6 0,7 AAGTCACCGTTTCAATCCAG GCAGTGCGCAAGTTTTCT HQ585434
PN03-H3 (GA)22 51,4 198-250 11 0,8 CATGTAAACGTAGCAGAGGT GCTAATTTTACAGGGTGGTC HQ585435
PA01-C8 (AT)2TTA(AT)2TTCA(GA)2 60 247-279 6 0,8 AATCTGACCTGTTTTACTTCTC TGCATTTTTGGGATACACT HM208140
PA01-E10 (GGT)2 T(ACT)2 54 186-210 6 0,4 GCGATTATTGTTGTTTGGTTTG ACGCTTTCTTGTCTTCATCTCA HM208141
Average     7,1 0,7    
  1. Ta primer annealing temperature, TD touchdown, NM number of markers, PIC polymorphism information content.
  2. PN Paspalum notatum SSR loci, PA P. atratum SSR loci.