Skip to main content

Table 3 Pyrosequencing primers and conditions used in the study

From: Isolation of human genomic DNA for genetic analysis from premature neonates: a comparison between newborn dried blood spots, whole blood and umbilical cord tissue

Oligonucleotide Sequence 5′-3′ Product size (bp) T (°C) Modifications
rs1835740PyroF CTCATTCGTTTTCTGCCTGTTG 300 60 None
rs1835740PyroR-BIO TCTTGCATATTTGAGCAGACTTTG 5′Biotin
rs1835740PyroSeq CACAACTTGATTCCAATCT N/A None
Target sequence GC/TGTATGTAGATT
Nucleotide dispensation order AGCTCGTAT
rs4354668PyroF-BIO GGGGCTAAACCTTGCAATC 166 60 5′Biotin
rs4354668PyroR GAGTGGCGGGAGCAGAGA None
rs4354668PyroSeq GGGTGTGTGCGCGCC N/A None
Target sequence T/GGGGGAGGCGGTGGAGGCC
Nucleotide dispensation order CGTGCAGCGTGAGCGTGC
  1. Primer pair rs1835740PyroF/rs1835740PyroR-BIO and rs4354668PyroF-BIO/rs4354668PyroR were used to generate biotinylated PCR products flanking SNPs rs1835740 and rs4354668, respectively. Primers rs1835740PyroSeq and rs4354668PyroSeq were used for pyrosequencing. The target sequence and the order of nucleotide dispensation for each pyrosequencing assay are listed. In the dispensation order the nucleotides used as negative controls for pyrosequencing are underlined. In optimal pyrosequencing conditions these nucleotides are not incorporated into the target DNA sequence and thus their addition do not generate peak on the pyrogram (see also Figure 2). The nucleotide change in the target sequence is indicated in bold.
\