Skip to main content

Table 3 List of primer pairs

From: Pseudogenization of the MCP-2/CCL8 chemokine gene in European rabbit (genus Oryctolagus), but not in species of Cottontail rabbit (Sylvilagus) and Hare (Lepus)

Gene Exon Primer name Sequence R-MPCgb
gDNA     
CCL8 ex1 FwPrCL8e1 5’ AGCACACGCAGGGTCTTGCT 3’ 47421-47440§
   RvPrCL8e1a 5’ ATGGCTCCCACTTGGATGGC 3’ 47692-47711
   RvPrCL8e1b 5’ TCGACCCCGTGGGCTGGTAG 3´ 48091-48110
  ex2 FwPrCL8e2a 5’ GCATCCAGCACGGTGGCTGT 3’ 48021-48040
   RvPrCL8e2a 5’ GCCAGCCCTTGCTCCTTGGG 3’ 48774-48793
  ex3 FwPrCL8e3b 5’ GGCTCCAGGTGCTTCAGCCA 3’ 48659-48678
   RvPrCL8e3b 5’AGTACCCAGGGAAGGCTGGG 3’ 49034-49054
CCL13 ex1 F1CL13e1 5’ TTGGCTCTCCCGTGGCAGCA 3’ 72054-72073
   R1CL13e1 5’ GGCCAGCACTATGGCGCAGT 3’ 72537-72556
   F9CL13e1 5’ AGGCAGCAAGCATGGGAGCG 3’ 71722-71741
   R9CL13e1 5’ GGGCCCTTTGGCTTAGAAGGCG 3’ 72226-72206
cDNA     
CCL8 CDS FwCCL8_CDS 5’ CTCCAAGCTCGGCTCCTTG 3’ 47548-47566
   RvCCL8_CDS 5’ ACTCTGAGTCTCAGTCCAGGTG 3’ 48990-49011
CCL7 CDS FwCCL7_CDS 5’ AGGCTGAGGCCAGCACAGGA 3’ 13720-13739
   RvCCL7_CDS 5’ TCCTCCCCCATGCCAGTGCA 3’ 11541-11560
  1. § NC_013687.1 REGION:2376421.23767440.