From: SNP variation in the promoter of the PRKAG3gene and association with meat quality traits in pig
SNPs | Putative transcription factors | Predictor | Recognition sequence | Created with | Start | End |
---|---|---|---|---|---|---|
g.-995A>G | CCAAT/enhancer-binding protein (α and ß) | TFSEARCH | CCCTTAGGCAATAT a | A | −1004 | −991 |
 |  | TESS | CTTAGGCAATAT |  |  |  |
 |  | MatInspector | CCCCTTAGGCAATAT |  |  | −991 |
 |  | Match™ ALIBABA2 | CCCCTTAGGCAATATAGG |  |  | −991 |
 |  |  |  |  | −1002 | −989 |
 |  |  |  |  | −1005 |  |
 | HNF-4 | Match™ | CCTTAGGCAATA AA c |  |  | −992 |
 |  |  |  |  |  | −992 |
 |  |  | CCTGCCCCTTAGGCAAT |  | −1005 |  |
 |  |  |  |  | −100 | −1010 |
g.-480C>T | Pax-4 | Match™ | CCGGGACCACCCACGAACTCC b, c | C | −481 | −460 |
g.-461C>T | SP1 | TFSEARCH | GCTGGGGAGGCGGAG a b | C | −472 | −458 |
 |  | TESS | CGGAGT GGGGAGGCGGA |  | −462 | −457 |
 |  | ALIBABA2 |  |  | −469 | −459 |
g.-311A>G | IK-1 | Match™ TFSEARCH | CGGTGGGAACACA a, c | G | −315 | −303 |
g.-221G>A | Myoblast Determining Factors | MatInspector | CGAGGACAGGTGAGAAG b, c | G | −221 | −205 |
g.-30C>T | RFX1 | Match™ | CTGTATCTGGGCAACAC b, c | T | −33 | −17 |