Skip to main content

Table 4 Primer sequences for the bovine ACSL1 gene applied for annotation confirmation, screening for polymorphisms and genotyping

From: Association of an ACSL1 gene variant with polyunsaturated fatty acids in bovine skeletal muscle

Primer Sequence (5' → 3') Gene region Amplicon (bp) Position in reference sequence AccNo. of reference sequence Application*
ACSL1_F1
ACSL1_R1
CCGAGCCCCAACCGAGAC
TGGACGCTGTTCTTGAGTGGTG
intron 1 -promoter 844 1918181 - 1918198
1919003 - 1919024
NW_001494406.2 SNP
ACSL1_E1_F3
ACSL1_E1SF
GACCCGAGCCCCAACCGAG
GTTGAGCCACCACAATTTACTC
intron 1 -promoter 497 1918178 - 1918196
1918674 - 1918653
NW_001494406.2 SNP
ACSL1_E1SR
ACSL1_R1
GGACTGCCCTGGATTTCACAAG
TGGACGCTGTTCTTGAGTGGTG
promoter 413 1918612 - 1918633
1919003 - 1919024
NW_001494406.2 SNP
ACSL1_F2
ACSL1_R2
TCGCTGCTGAAGTCCTGTCTG
GCTCTAATGCCCCCGTTGATG
exon 2 501 1897290 - 1897310
1897770 - 1897790
NW_001494406.2 SNP
ACSL1_F3
ACSL1_R3
TTGCGTGGGAGAGAGTTGTG
TCAGGTGGAGGATTTATGTCAG
exon 3 384 1882758 - 1882777
1883120 - 1883141
NW_001494406.2 SNP
ACSL1_F4
ACSL1_R4
GCATCCACACTCCATAGAAAC
AATAAAGAAGCAAAACTCAGACC
exon 4 345 1881998 - 1882018
1882320 - 1882342
NW_001494406.2 SNP
ACSL1_F5
ACSL1_R5
ATGAAAGGGAAAAGTGAAAGTG
CTTGAGTTGGACCTGATGCTG
exon 5 457 1878288 - 1878309
1878724 - 1878744
NW_001494406.2 SNP
ACSL1_F6
ACSL1_R6
CGGCTGGAAGTAAAGAGACAC
TTGTGTTCTTCATCCTCCTTTC
exon 6 574 1875840 - 1875860
1876392 - 1876413
NW_001494406.2 SNP
ACSL1_F7
ACSL1_R7
GTTCTCTTTTACAGGACCAG
CAGGGATGCTTTACTTACTC
exon 7 600 1875542 - 1875561
1876122 - 1876141
NW_001494406.2 SNP
ACSL1_F8_9
ACSL1_R8_9
TGGGTGATGTAAATGTGTGAGG
ATGATAGGAATGGCAGTGGAGAC
exons
8-9
750 1872567 - 1872588
1873294 - 1873316
NW_001494406.2 SNP
ACSL1_F10
ACSL1_R10
ATCTGTATTTCAGGTACTGTTTC
GTTTATGGGCTTCTCTCACG
exon 10 287 1871656 - 1871678
1871923 - 1871942
NW_001494406.2 SNP
ACSL1_F11
ACSL1_R11
TACACACTTGAACTTACCAG
TGTGCTCTGAAATAAATGG
exon 11 314 1869171 - 1869190
1869466 - 1869484
NW_001494406.2 SNP
ACSL1_F12
ACSL1_R12
TCTGTATTGTGCCTTCTGATG
GGAAACTGGGCTGAAATGC
exon 12 371 1866801 - 1866821
1867153 - 1867171
NW_001494406.2 SNP
ACSL1_F13
ACSL1_R13
TCTCACACAATAAAGGGGTAGG
TCCACATCTTCACCAACACTC
exon 13 516 1864669 - 1864690
1865164 - 1865184
NW_001494406.2 SNP
ACSL1_F14
ACSL1_R14
AAGCCGCCCAGGAATAACAC
TGCCACAAACCCACGACACT
exon 14 516 1863888 - 1863907
1864384 - 1864403
NW_001494406.2 SNP
ACSL1_F15
ACSL1_R15
GACTTGTGTTTATTTCTGCCTG
TGGGCTGAGGTTTCTAATCC
exon 15 524 1862774 - 1862795
1863278 - 1863297
NW_001494406.2 SNP
ACSL1_F16
ACSL1_R16
TGCTGAGAAGTGGCTGGTTAC
CATGAGAACAGGGCTTATTGG
exon 16 247 1860135 - 1860155
1860361 - 1860381
NW_001494406.2 SNP
ACSL1_F17
ACSL1_R17
ATGCGAGGGAGAAAGAGG
CCGCTAACAAAAAGAACAGTG
exon 17 427 1859039 - 1859056
1859445 - 1859465
NW_001494406.2 SNP
ACSL1_F18
ACSL1_R18
GGCAAACTTCCCATTACACTG
GACTCCTTCATCCCTTCTCTG
exon 18 512 1857386 - 1857406
1857877 - 1857897
NW_001494406.2 SNP
ACSL1_F19_20
ACSL1_R19_20
GCCAAAGCACACCACTCTC
CGAAGCAGATAATAAGGAACTAC
exons 19-20 517 139425 - 139443
139919 - 139941
NW_930554.1 SNP
ACSL1_F21
ACSL1_R21
CACCCGCCTTTGTAACTG
GTCCTGATTCTGTCCTGATGTC
exon 21 548 138819 - 138836
139345 - 139366
NW_930554.1 SNP
ACSL1_UTR_F31
ACSL1_UTR_R3
AAACCCTCTGGTCCTCTTGCG
CAATGGCAGGAAGGGAGGGAG
exon 21 404 138633 - 138653
139016 - 139036
NW_930554.1 SNP
ACSL1_UTR_F2
ACSL1_UTR_R21
GAGTTTTCCAGATTCCTATGTCC
CCTGTTACCCTCCCTTCCCTG
exon 21 650 137966 - 137988
138595 - 138615
NW_930554.1 SNP
ACSL1_UTR_F11
ACSL1_UTR_R1
ATGCGACTGCTGACATGAAAAAC
AAATAAATGCTCTTCTGTCGTAATG
exon 21 527 137530 - 137552
138032 - 138056
NW_930554.1 SNP
ACSL1_E1_F3
ACSL1_E1_R2
GACCCGAGCCCCAACCGAG
GCTCGTAGGCTGCAGCGAG
intron 1-promoter 220 1918178 - 1918196
1918379 - 1918397
NW_001494406.2 GT
ACSL1_F7
ACSL1_R7
GTTCTCTTTTACAGGACCAG
CAGGGATGCTTTACTTACTC
exon 7 600 1875542 - 1875561
1876122 - 1876141
NW_001494406.2 GT
(PCR-RFLP)
ACSL1_E1_F5
ACSL1_E1_R3
ACSL1_E1_F7_T
ACSL1_E1_R8_C
GGAGGGAACTCGGGGAGCC
AGGGCGGGGCTGAGACGG
GCTATTTAAGGGTGCCGCCGT
GCAGCCAGCTCTCGGAAGTAG
promoter 451
316
175
1918052 - 1918070
1918485 - 1918502
1918328 - 1918348
1918348 - 1918368
NW_001494406.2 GT
(Tetra-ARMS PCR)
ACSL1_E1_F2
ACSL1_E5_R1
CGGAGGAGACTGTGGCTTAG
CTGAGCGAAGATGCCAATAAAC
exons
1-5
505 38 - 58
521 - 543
NM_001076085.1 cDNA
ACSL1_E5_F1
ACSL1_E12_R2
CAGTTTATTGGCATCTTCGCTC
GGAAGATGGTGGGTTGAAGG
exons
5-12
649 519 - 541
1148 - 1168
NM_001076085.1 cDNA
ACSL1_E11_F2
ACSL1_E18_R1
CCATATGTTTGAGAGAGTTGTAG
ATGTACTCCCCCTGTGCCAG
exons 11-18 735 1046-1069
1761 - 1781
NM_001076085.1 cDNA
ACSL1_E17_F2
ACSL1_E21_R2
CTGGATAAAGACGGCTGGTTG
GAGTTCAGGGTGGAGATAGATG
exons 17-21 399 1665 - 1686
2042 - 2064
NM_001076085.1 cDNA
ACSL1_E21_R3 GTCAAACTCCCCTCCGCTTC exons 17-21 540 2185 - 2205 NM_001076085.1 cDNA, RT
ACSL1_E21_R4 CAGAAAGAGCAAAGTCCTAACC    2454 - 2476 NM_001076085.1 cDNA, RT
  1. * cDNA: analysis of cDNA structure, RT: reverse transcription, GT: genotyping, SNP: screening for polymorphisms