Skip to main content

Table 3 List of primer sequences used for typing MUC4 polymorphisms and quantitative PCR

From: Analysis of porcine MUC4 gene as a candidate gene for prolificacy QTL on SSC13 in an Iberian × Meishan F2 population

Application SNP/Gene Primer Sequence (5' →3') Length (bp)
Pyrosequencing PCR DQ124298:g.243A>G F: *tggtgctacccccagatttg  
   R: gttgtgtccaccccttacccttat 195
   P: gtcccctctcccaggta  
  DQ124298:g.344A>G F: *gtggccctcagtcactagagt  
   R: cgaagttgtgaaaggaagacag 258
   P: ttggggttggggcag  
qPCR MUC4 F: atgggcttctccagtggagat 66
   R: tctcccacactggctgcaa  
  1. * 5' Biotin labelled, F forward primer, R reverse primer, P pyrosequencing primer