Skip to main content

Table 1 PCR primers used to amplify rat Edaradd cDNA

From: A rat model of hypohidrotic ectodermal dysplasia carries a missense mutation in the Edaradd gene

Primer set Forward (5' > 3') Reverse (5' > 3')
Edaradd-1&2 CTGAGAGAGAGTCGCGCATT GCCACAGCTGTTCCCATAG
Edaradd-3&4 GCCCAGAAAAGGCAGCTC GGAAAACCTTTGGAGTTTCTGA
Edaradd-5&6 CGATGAGCCAGCTTTACCTC GGATAATTGGGTAACTATTCTCAACC
Edaradd-7&8 TCCATCCCAATTTTACCAACA CGGCAAGCATTTTAATGACC
Edaradd-9&10 CAGTCAGCCCCTTGCACT GCATGCTCTCATCAACATGG
Edaradd-11&12 TGTCACCAATGTGGTAGAAAAA CAGGGATAACCACTGCCTGT