Skip to main content

Table 1 Oligonucleotides

From: Characterisation of a novel paralog of scavenger receptor class B member I (SCARB1) in Atlantic salmon (Salmo salar)

Oligonucleotide combination Oligonucleotide forward (5'-3') Oligonucleotide reverse (5'-3') Size (bp)
1: Intron 3 AGCGTCTTCAGAAGCAGAAC CCACATCAGCTCTCCTACAG 350
2: Intron 4 CTACGACAGCAAGCTGGTGGACTT GGTCAAGCCGTTCCATGAGTTCAC 600-700
3: Intron 5 CTCCCCAGTGTAACATGATCAACGG CAGATTGTCTGCAGGGACAGAAGC 600
4: Intron 10 GGGAAGATCTCAGAGGTTGT TACACCATCACCATTGGCAA 500
5: Exon 4 and 5 CTACGACAGCAAGCTGGTGGACTT GATGTCATCTTCGCCGGTATGGATT 138
6: cDNA CGTTGGACCAATCATTATCGACA TCTGTAGTGTAGTAGTACAGCTCCCAGAG 1308
7: cDNA ATGAATAAATCTAAATTAGCGATCGGA TGTCATCTTCGCCGGTATGGATT 672
8: cDNA TGATGGAGAACTTGCCGTTCC CCCTGCAGCACTGGGCTAGACT 1054
  1. Oligonucleotides used for PCR-amplification, QTL-mapping and real-time PCR of the two SCARB1 paralogs in Atlantic salmon.