Skip to main content

Table 1 SNP identified in LAP3, LCORL, and NCAPG genes in crossbred steers.

From: Association, effects and validation of polymorphisms within the NCAPG - LCORL locus located on BTA6 with feed intake, gain, meat and carcass traits in beef cattle

Gene 1 Marker Name2 Accession Number dbSTS _Id ss # SNP3 Position in Gene4 Location on BTA65 For Primer Name For Primer Seq Rev Primer Name Rev Primer Seq
LAP3 79140_312 GF102128 1233209 196003657 INDEL p.E47del 37964162 LAP3-EX2F GCCTTGTTCTTTTGTCCTTGAG LAP3-EX2R TTGGGTTGAAGTAGCCTGATTT
LAP3 79144_139 GF102139 1233220 196003658 S p.D92E 37966065 LAP3-EX4F ACCAAATTTCTTGGGGAGTTTT LAP3-EX4R AACACTGCAAGAGGGAACAAAT
LAP3 79146_218 GF102161 1233242 196003659 Y c.504C>T 37967629 LAP3-EX5F GGGAAGAAGTGAAAGCTCAGAA LAP3-EX5R AAACTGACTAGGGCCATGAGAG
LAP3 79150_94 GF102129 1233210 196003660 Y c.834C>T 37971945 LAP3-EX7F CATTTTTCATTTCCTGCCTTGT LAP3-EX7R GTAAGCAAAGGGAAGACAGCAT
LAP3 79152_265 GF102108 1233189 196003661 Y   37977863 LAP3-EX8F TGGAAATTTCTTGGTGCTTGTA LAP3-EX8R CTGACTGCTAACCACATTTTGC
LAP3 79154_194 GF102068 1233149 196003662 Y   37979109 LAP3-EX9F CACACTCCATGTTCCTTCATGT LAP3-EX9R TGCAGGACTTGTTTTCTTCTCA
LAP3 79154_347 GF102068 1233149 196003663 S   37979262 LAP3-EX9F CACACTCCATGTTCCTTCATGT LAP3-EX9R TGCAGGACTTGTTTTCTTCTCA
LAP3 79158_103 GF102082 1233163 196003664 S   37984197 LAP3-EX11F AGGATTTGCCAACATCATCTTT LAP3-EX11R CCATGCCTTCTTTTACAAAGCTA
LAP3 79158_104 GF102082 1233163 196003665 R   37984198 LAP3-EX11F AGGATTTGCCAACATCATCTTT LAP3-EX11R CCATGCCTTCTTTTACAAAGCTA
LAP3 79160_105 GF102096 1233177 196003666 Y   37985986 LAP3-EX12F ATTTCAGCAAATGCCCTACAAT LAP3-EX12R TTGAAAATGCAAAAACCAGTTG
LAP3 79162_241 GF102069 1233150 196003667 K c.*1641T>G 37986804 LAP3-EX13F TGGGGTTAGATGTTGATTTTTG LAP3-EX13R GTGAATATGAGAGCCACACCAG
LAP3 79162_246 GF102069 1233150 196003668 Y c.*1646C>T 37986809 LAP3-EX13F TGGGGTTAGATGTTGATTTTTG LAP3-EX13R GTGAATATGAGAGCCACACCAG
LAP3 79162_438 GF102069 1233150 196003669 R c.*1838A>G 37987001 LAP3-EX13F TGGGGTTAGATGTTGATTTTTG LAP3-EX13R GTGAATATGAGAGCCACACCAG
NCAPG 83704_234 GF110810 1241907 263198259 R   38157198 NCAPG-EX4-F TCTGTCCTTTTCAAGGGATGTT NCAPG-EX4-R CAGCCACACAATAATGCGATAG
NCAPG 83704_335 GF110810 1241907 263198262 S   38157299 NCAPG-EX4-F TCTGTCCTTTTCAAGGGATGTT NCAPG-EX4-R CAGCCACACAATAATGCGATAG
NCAPG 83704_358 GF110810 1241907 263198260 W   38157322 NCAPG-EX4-F TCTGTCCTTTTCAAGGGATGTT NCAPG-EX4-R CAGCCACACAATAATGCGATAG
NCAPG 83704_366 GF110810 1241907 263198261 R   38157330 NCAPG-EX4-F TCTGTCCTTTTCAAGGGATGTT NCAPG-EX4-R CAGCCACACAATAATGCGATAG
NCAPG 83708_361 GF110811 1241908 263198263 Y   38158932 NCAPG-EX6-F GATGGAAGCTAGAGGGGAACTT NCAPG-EX6-R CTTTTCATGGTAGGCCTAATGC
NCAPG 83712_168 GF110812 1241909 263198264 R c.1261A>G 38163729 NCAPG-EX8-F TTCTCACTTAATGGGGAGCTGT NCAPG-EX8-R AAATTTTAAGCAAAAACCTGCAA
NCAPG 83712_422 GF110812 1241909 263198265 R   38163983 NCAPG-EX8-F TTCTCACTTAATGGGGAGCTGT NCAPG-EX8-R AAATTTTAAGCAAAAACCTGCAA
NCAPG 83714_209 GF110813 1241910 263198266 M c.1357A>C 38164388 NCAPG-EX9-F TTTCAGAATGTGAATTTTGGCTTA NCAPG-EX9-R GTGTGAAAGGGACTGGGTTTTA
NCAPG 83714_224 GF110813 1241910 263198267 K p.I442M 38164403 NCAPG-EX9-F TTTCAGAATGTGAATTTTGGCTTA NCAPG-EX9-R GTGTGAAAGGGACTGGGTTTTA
NCAPG 83724_658 GF110818 1241915 263198273 Y c.2158T>C 38180790 NCAPG-EX14-F ATTTACTTTTGGTGGGGGATGT NCAPG-EX14-R CAACCTCCCAATAGTCATTTCA
NCAPG 83726_315 GF110815 1241912 263198269 R   38192653 NCAPG-EX15-F ATGTAAGGCCTAAAAGGGAGGT NCAPG-EX15-R GGAAAGAGCCAAATAATTCAGG
NCAPG 83730_778 GF110816 1241913 263198270 M p.L877M 38195339 NCAPG-EX17-F GAGCGTGAATGGTTCAGTACAC NCAPG-EX17-R ACTTCAAGAAATGAGCACCAAA
NCAPG 83732_316 GF110819 1241916 263198271 R   38195743 NCAPG-EX18-F AGTATTTGGTGCTCATTTCTTGA NCAPG-EX18-R TCCCAAGTGAATTTAATTAGAAAAA
LCORL 79205_443 GF102113 1233194 196003679 R   38233294 LOC540095-EX6F CCTATGTAGTGCCTTCCCAGTC LOC540095-EX6R CTCGTCCTGCTTCTTAGTTTGT
LCORL 81441_243 GF102084 1233165 196003694 Y   38255270 LOC540095-IN4.4F GCATGAATGACAAAACTGTGCT LOC540095-IN4.4R CATTTTGCCCTTAAGCCTTCTA
LCORL 81439_210 GF102101 1233182 196003693 R   38257174 LOC540095-IN4.3F TTTGCCTTCAGTTCTCTTAGGC LOC540095-IN4.3R TTGCAAAATTATGGCATTTCAC
LCORL 81435_188 GF102143 1233224 196003692 Y   38284737 LOC540095-IN4.1F TAGCCTGACTGCATCCATCTAA LOC540095-IN4.1R GGAAATCCCTGGTTAAGAATCC
LCORL 79197_655 GF110814 1241911 263198268 R   38327100 LOC540095-EX2F TCTCACGTAGAGTGTATGGATAAGC LOC540095-EX2R GAGTTCCAGGCTGCCTATATCA
LCORL 81433_176 GF110817 1241914 263198272 Y   38314844 LOC540095-IN3.1F GCAGGTGAAAATCCCAATACAC LOC540095-IN3.1R GGGCCAAACTAGCCTTATTTCT
LCORL 81419_461 GF102100 1233181 196003691 M   38342145 LOC540095-IN1.9F GACTTCAAATTTTTGCCCAGAG LOC540095-IN1.9R GGTGTTCTTACCCTGTCTCAGC
LCORL 81413_159 GF102115 1233196 196003686 S   38359337 LOC540095-IN1.6F AGGATCAACCATTAGGATGTGC LOC540095-IN1.6R AACTGGGAAGAGAGCAAGTGAG
LCORL 81413_221 GF102115 1233196 196003684 W   38359399 LOC540095-IN1.6F AGGATCAACCATTAGGATGTGC LOC540095-IN1.6R AACTGGGAAGAGAGCAAGTGAG
LCORL 81413_226 GF102115 1233196 196003687 W   38359404 LOC540095-IN1.6F AGGATCAACCATTAGGATGTGC LOC540095-IN1.6R AACTGGGAAGAGAGCAAGTGAG
LCORL 81413_231 GF102115 1233196 196003689 M   38359409 LOC540095-IN1.6F AGGATCAACCATTAGGATGTGC LOC540095-IN1.6R AACTGGGAAGAGAGCAAGTGAG
LCORL 81413_238 GF102115 1233196 196003690 W   38359416 LOC540095-IN1.6F AGGATCAACCATTAGGATGTGC LOC540095-IN1.6R AACTGGGAAGAGAGCAAGTGAG
LCORL 81405_282 GF102099 1233180 196003685 M   38376731 LOC540095-IN1.2F TCGGGTCCTCTTTTACTGTCAT LOC540095-IN1.2R CTTACCACGATCTCCTTTCCAC
  1. 1 SNP in bold were genotyped using the Sequenom MassArray System.
  2. 2 Marker name in USMARC database.
  3. 3 IUB Codes for SNP are K = G/T, M = A/C, R = A/G, S = C/G, W = A/T, Y = C/T.
  4. 4 Position based on NM_174098 Bos taurus leucine aminopeptidase 3 (LAP3) mRNA; NM_001102376 Bos taurus non-SMC condensin I complex, subunit G (NCAPG), mRNA; and NM_001192357 Bos taurus ligand dependent nuclear receptor corepressor-like (LCORL) mRNA.
  5. 5 Position based on the Btau 4.0 genome assembly.
\