Skip to main content

Table 2 Detail information for primers of the chicken DRD1 gene

From: The genetic effects of the dopamine D1 receptor gene on chicken egg production and broodiness traits

Primer name Primer sequence
(5'→3')
Length1 (bp) Location2 AT3 (°C) Genotyping method
P1 F:CCGGTGAGTACCCTGCTTT
R:GTGCTTTTCCTCTGCTTTGG
1504 -1961 ~ -458 59 /
P2 F:AGTGAAGAATTGCTCGCTGA
R:GGTTTTGCTGGGTACACCTT
1970 -589 ~ +1381 57 /
P3 F:CACTATGGATGGGGAAGGGTTG
R: GGCCACCCAGATGTTGCAAAATG
283 G+123A
T+198C
62 BseNI
cfrI
P4 F: CAGCCCATTCAGGTACGAGAGGA
R: ATTCGACTCTTTGGGGCTGGAC
793 A+505G
C+765T
C+1011T
G+1065A
C+1107T
65.5 sequencing
P5 F: TTTCCTTCATCCCCGTGCAGCT
R: GCTGCTTCTGTTGCCACTTGTGT
290 +458 ~ +747 63 /
P6 (actin) F: CCCCAAAGCCAACAGAGAGA
R: GGTGGTGAAGCTGTAGCCTCTC
274 / 63 /
  1. 1The length of PCR products; 2referred to the locations in the DRD1 gene, the first nucleotide of translation start codon was designated as +1. 3indicated annealing temperature.