Skip to main content

Table 1 Oligonucleotide primer sequences used for comparison of HRM and sequencing sensitivity and specificity.

From: Determining the effectiveness of High Resolution Melting analysis for SNP genotyping and mutation scanning at the TP53 locus

Amplicon Forward sequence 5'>3' Reverse sequence 5'>3' Location size
3 CGGGACGTGAAAGGTTAGAA TTTTGGGGTGGAAAATTCTG promoter 653
39 TGGCCATCTACAAGCAGTCA ACACGCAAATTTCCTTCCAC exon5-intron5 211
40 CATGAGCGCTGCTCAGATAG CAGTTGCAAACCAGACCTCA exon6 234
41 GTGGAAGGAAATTTGCGTGT TTGCACATCTCATGGGGTTA intron6 212
43 TGGCTCTGACTGTACCACCA TCTACTCCCAACCACCCTTG intron 7 371
44 CTGGAAGACTCCAGGTCAGG AGCTGTTCCGTCCCAGTAGA intron7 383
46 GCGCACAGAGGAAGAGAATC TGAAAGCTGGTCTGGTCCTT intron9 452
47 GCAGTGATGCCTCAAAGACA GCAGGCTAGGCTAAGCTATGA intron9 280
48 TGACTTTGCCTGATACAGATGC TAGCTACTGGGGAGGCAGAG intron9 596
49 GGCCTGCCTAGCCTACTTTT GTAGCAGGCGCTTGTAGTCC intron9 578
50B GACTACAAGCGCCTGCTACC TTTCATGCAACCATGCTGTT intron9 614
51 CCCTACAGTTGGGCAAAGTC CGACTGTGCCTCGTTTCTTT intron9 491
52A CCTGGGCGATAGAGTGAGAC GGCTGGACTCAAACTCTTGG intron9 134
52B GTCGCATGCACATGTAGTCC CTTGAGTTCCAAGGCCTCAT intron9 635
53 ACTTCTCCCCCTCCTCTGTT CCTGGGTTTGGATGTTCTGT exon10-intron10 348
55 TATACTCAGCCCTGCCATGC GGACTTCAGGTGGCTGTAGG intron10 603
57 TTTGGGTCTTTGAACCCTTG GTGGTTTCAAGGCCAGATGT exon11 (3'UTR) 400
58 GGCCCACTTCACCGTACTAA AAGCGAGACCCAGTCTCAAA exon11 (3'UTR) 485
59 AAGGAAATCTCACCCCATCC AAATGCAGATGTGCTTGCAG exon11 (3'UTR) 456
60 TTGAGACTGGGTCTCGCTTT CAGTCTCCAGCCTTTGTTCC   566
61 AAAACTTTGCTGCCACCTGT ATCCTGCCACTTTCTGATGG   415
62 GCCTCTCACCAAGGATTACG CCTGGACAGTAGCACCCACT   535