Skip to main content

Table 1 Primers used for PCR and sequencing.

From: Similar patterns of linkage disequilibrium and nucleotide diversity in native and introduced populations of the pea aphid, Acyrthosiphon pisum

Locus Forward primer Reverse primer
CAA-1 TAAACGTTTCGGTTTCTGTTCC AGGGATATCCAGGATGGTTTG
CAA-2 TACATTGCGCACTATAAATTAGGG ATTAAGTCACCAACCTTTTCCAAC
380–1 ACGGTATCGAATCCCCTTAAAAAC AGATACCGCAGAACTAGTGGAATG
380–2 TAAAGCCGCATCCTATAAACTCTC TAATACGGTCGTCTGTCACAACTC
380-int1 TTCGAATGTAATTTATTTACCAGG  
380-int2 CCTCTAAATACGGCCCTGATGAACC  
380-int3 AAACTGTTTAACTCACAAAG  
870–1 CTATGTGGATGTTGATACCGAAAG TTCCGTATGCTATATTTCCGTCTG
870–2 AACTTCTAAATACCGGACAATCTCG CAAACTGTCCTCTGAGAAATGAGAGG
870-int TGAAAGCCCAGACGTCGATGCTAGC  
41-1 CTTCTGCCAGTCACAAACAATC CGATGAAGATCTTTCACTGCAC
41-2 AACTAAGCCGTCTGCGTTACTC CATTTACACGGTACCGACATTG