Skip to main content

Table 1 PCR primers used in this study

From: Mutations in genes involved in nonsense mediated decay ameliorate the phenotype of sel-12 mutants with amber stop mutations in Caenorhabditis elegans

Product Sense primer Antisense primer enzyme
Rpl-12 GN1100 GTTGCGTCGGAGGAGAAGTCG GN1101 GATGATGTCGTGTGGGTGTTGTC  
ama-1 GN701 GTCACATGAAAGATGGCGATATAA GN702 CATCATTGACTTTTGTGGAGAGT  
Eft-2 GN739 ACTTGTTGGAGTCGATCAATACCT GN740 GACTGGAGATACGGAGAACTTCAT  
nhx-4 GN753 GGGTTGTACCATTAAGTTCGTCAT GN754 TACTTGTCGTTCAGGTGAGTAAGC  
sel-12-1 GN854 GGAGCATCTCACGTTATTCATCTA GN855 CCCGGACAAAAGGAGTGTATAGTA  
sel-12-3 GN876 TGGACTGGGTAACTATGGAGTTCT GN877 GATAAAGACCAGAGCCATTAGTGC  
sel-12-5 GN880 AGAGAGAGGTGTGAAACTTGGTCT GN881 AGTGAAGCAGAGACCGATAAGAAT  
sel-12-6 GN882 CTTCCACAAGGAGACAACAGG GN883 ATAACGTGAGATGCTCCGTATTTC  
Y22D7AL[4] GN37 CTTACGCCAAGGACGTCAAG GN38 GGTATTTGTCCTTGAGGTCG DraI
pkP3086 GN553 TTGAGAAGAATGAGCAGAGCGG GN554 AACTGATGGCCTAGAAATCCAAGGAGTTCG DdeI
Y71H2B[2] GN39 AAGAAGAATTAGGCGATGCGG GN40 CTGAAAACTTGGAAAATCGGTG DraI
C48B6[1] GN124 GTCAAGGACCATTGTTACGAG GN125 GGGCAGTTATTAGTTCGTGAG DraI
byP4 GN1008 GAAATTTCAGTGCCACTTCC GN1009 CTAGGCAGTACATAAATGCG KpnI
smg-1(by146) GN1222 CTTCATCTTGATGAACGAGTCATGC GN1213 AGAAGTAGAACGGACTATGACACG  
smg-1(by146) GN1222 CTTCATCTTGATGAACGAGTCATGC GN1264 CATGATCTGCGAATGCTAGACG  
  1. Primers used for quantitative PCR, the rpl-12 test and Single Nucleotide Polymorphism (SNP) mapping are noted. For SNPs, the restriction enzyme used to detect the polymorphism in indicated in the last column.