Skip to main content

Table 2 Primers used for mtDNA specific amplification and for amplifying across Numt junctions

From: Mitochondrial pseudogenes in the nuclear genome of Aedes aegypti mosquitoes: implications for past and future population genetic studies

Region amplified Forward primer Reverse primer Fragment size (bp)
Clade 2 specific ND4 gene region ATGATAATTATACAATGAATTTTA AACTCCCCCAATTAAGCTAATACTA 282
Start junction of Numt on 1.363 GCTGGTGTGTGCATGAAACTAATC TCGCGATTAAATGGCTGAAG 406
End junction of Numt on 1.363 TCAAACGGACGAAGTTTGAGACAG AAACCATGCCATTCCTTGAG 444
Start junction of Numt on 1.593 ATAAGTGAGCCGAAGACACCGAG GTCCGGTCTAGGGTCCTTTC 413
Start junction of Numt on 1.1330 TCACAATCACAGCCACTTTTCC CCTATTCAAAACAGGTTTCGTTCAAG 412